\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133680937:

Variant ID: vg0133680937 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33680937
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCCACTAGTTAGCCTCCTTCTTCTCCTCTCCTCTCTCCCTCCGATGCTACGCGTCCTCCGGCGCCACCATTCCGCCGGCGACGCTGCTACGAGGGGCCC[G/A]
TCCGGTGCCGCTACGCCTCCTCCGCCAACGCCGCCGCCGCGAGGGGCCCGTCCGCCGCCGCTTCGCCTCCTCTGCCAGCGCTGCCGCCGCTAAGCTTCCT

Reverse complement sequence

AGGAAGCTTAGCGGCGGCAGCGCTGGCAGAGGAGGCGAAGCGGCGGCGGACGGGCCCCTCGCGGCGGCGGCGTTGGCGGAGGAGGCGTAGCGGCACCGGA[C/T]
GGGCCCCTCGTAGCAGCGTCGCCGGCGGAATGGTGGCGCCGGAGGACGCGTAGCATCGGAGGGAGAGAGGAGAGGAGAAGAAGGAGGCTAACTAGTGGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 3.90% 2.03% 0.70% NA
All Indica  2759 99.90% 0.00% 0.11% 0.00% NA
All Japonica  1512 80.40% 11.80% 5.75% 2.12% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.10% 0.38% 0.00% NA
Temperate Japonica  767 90.50% 1.00% 6.65% 1.83% NA
Tropical Japonica  504 79.80% 16.10% 3.97% 0.20% NA
Japonica Intermediate  241 49.40% 36.90% 6.64% 7.05% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 92.20% 2.20% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133680937 G -> A LOC_Os01g58280.1 upstream_gene_variant ; 3841.0bp to feature; MODIFIER silent_mutation Average:80.377; most accessible tissue: Zhenshan97 panicle, score: 92.27 N N N N
vg0133680937 G -> A LOC_Os01g58270.1 downstream_gene_variant ; 1220.0bp to feature; MODIFIER silent_mutation Average:80.377; most accessible tissue: Zhenshan97 panicle, score: 92.27 N N N N
vg0133680937 G -> A LOC_Os01g58270-LOC_Os01g58280 intergenic_region ; MODIFIER silent_mutation Average:80.377; most accessible tissue: Zhenshan97 panicle, score: 92.27 N N N N
vg0133680937 G -> DEL N N silent_mutation Average:80.377; most accessible tissue: Zhenshan97 panicle, score: 92.27 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0133680937 G A 0.03 0.03 0.03 0.02 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133680937 NA 2.71E-07 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 5.25E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 1.69E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 7.58E-09 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 3.96E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 6.35E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 7.95E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 6.46E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 1.50E-06 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 5.99E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 6.20E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 1.88E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 9.17E-08 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 9.36E-06 1.62E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 1.94E-07 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 2.26E-07 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 9.61E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 8.96E-07 5.81E-10 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 3.99E-07 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 NA 2.48E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 9.37E-08 5.46E-09 mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 6.80E-07 4.99E-11 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133680937 2.01E-06 NA mr1962_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251