\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133648958:

Variant ID: vg0133648958 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33648958
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, A: 0.45, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTCCATCTCTTATAGTTTGAACCATCAAAAGCATGTGGTTTCAGTGCAGCAGCAAAGCCAACTACCGAAAATGACCTATCAGGTTTTTGGATTGTTGG[C/A]
AATATAGTCATTAATCGGCATATTTTAATCCAAGAAATTGAAACAATGATCATGGCATAAGCAGCGTAGGGTGATCTTAACATAACCAGTAGCATACTAT

Reverse complement sequence

ATAGTATGCTACTGGTTATGTTAAGATCACCCTACGCTGCTTATGCCATGATCATTGTTTCAATTTCTTGGATTAAAATATGCCGATTAATGACTATATT[G/T]
CCAACAATCCAAAAACCTGATAGGTCATTTTCGGTAGTTGGCTTTGCTGCTGCACTGAAACCACATGCTTTTGATGGTTCAAACTATAAGAGATGGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 35.90% 12.21% 13.99% NA
All Indica  2759 5.70% 53.60% 17.40% 23.31% NA
All Japonica  1512 97.60% 0.20% 1.46% 0.79% NA
Aus  269 2.20% 74.00% 23.79% 0.00% NA
Indica I  595 7.10% 37.80% 15.29% 39.83% NA
Indica II  465 2.60% 62.20% 13.55% 21.72% NA
Indica III  913 3.80% 60.00% 22.23% 13.91% NA
Indica Intermediate  786 8.50% 53.20% 15.65% 22.65% NA
Temperate Japonica  767 96.30% 0.30% 2.61% 0.78% NA
Tropical Japonica  504 99.00% 0.00% 0.20% 0.79% NA
Japonica Intermediate  241 98.30% 0.40% 0.41% 0.83% NA
VI/Aromatic  96 95.80% 2.10% 2.08% 0.00% NA
Intermediate  90 70.00% 13.30% 10.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133648958 C -> A LOC_Os01g58220.1 downstream_gene_variant ; 2184.0bp to feature; MODIFIER silent_mutation Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg0133648958 C -> A LOC_Os01g58220.2 downstream_gene_variant ; 2184.0bp to feature; MODIFIER silent_mutation Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg0133648958 C -> A LOC_Os01g58194.1 intron_variant ; MODIFIER silent_mutation Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N
vg0133648958 C -> DEL N N silent_mutation Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133648958 NA 1.37E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 2.75E-07 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 6.62E-14 2.80E-139 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 2.97E-08 7.04E-15 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 6.19E-14 3.71E-137 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 3.28E-08 2.38E-14 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 6.79E-10 9.27E-88 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 1.80E-06 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 6.67E-10 7.69E-90 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 1.60E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 2.62E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 2.36E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 1.35E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 1.35E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 1.41E-09 4.86E-131 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 1.36E-06 2.60E-14 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 1.06E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 6.71E-06 1.51E-96 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 9.01E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 6.97E-09 2.15E-32 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 1.83E-07 5.98E-09 mr1051_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133648958 NA 1.69E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251