\
| Variant ID: vg0133648958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33648958 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.55, A: 0.45, others allele: 0.00, population size: 80. )
CTTTCCATCTCTTATAGTTTGAACCATCAAAAGCATGTGGTTTCAGTGCAGCAGCAAAGCCAACTACCGAAAATGACCTATCAGGTTTTTGGATTGTTGG[C/A]
AATATAGTCATTAATCGGCATATTTTAATCCAAGAAATTGAAACAATGATCATGGCATAAGCAGCGTAGGGTGATCTTAACATAACCAGTAGCATACTAT
ATAGTATGCTACTGGTTATGTTAAGATCACCCTACGCTGCTTATGCCATGATCATTGTTTCAATTTCTTGGATTAAAATATGCCGATTAATGACTATATT[G/T]
CCAACAATCCAAAAACCTGATAGGTCATTTTCGGTAGTTGGCTTTGCTGCTGCACTGAAACCACATGCTTTTGATGGTTCAAACTATAAGAGATGGAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.90% | 35.90% | 12.21% | 13.99% | NA |
| All Indica | 2759 | 5.70% | 53.60% | 17.40% | 23.31% | NA |
| All Japonica | 1512 | 97.60% | 0.20% | 1.46% | 0.79% | NA |
| Aus | 269 | 2.20% | 74.00% | 23.79% | 0.00% | NA |
| Indica I | 595 | 7.10% | 37.80% | 15.29% | 39.83% | NA |
| Indica II | 465 | 2.60% | 62.20% | 13.55% | 21.72% | NA |
| Indica III | 913 | 3.80% | 60.00% | 22.23% | 13.91% | NA |
| Indica Intermediate | 786 | 8.50% | 53.20% | 15.65% | 22.65% | NA |
| Temperate Japonica | 767 | 96.30% | 0.30% | 2.61% | 0.78% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 95.80% | 2.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 13.30% | 10.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133648958 | C -> A | LOC_Os01g58220.1 | downstream_gene_variant ; 2184.0bp to feature; MODIFIER | silent_mutation | Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg0133648958 | C -> A | LOC_Os01g58220.2 | downstream_gene_variant ; 2184.0bp to feature; MODIFIER | silent_mutation | Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg0133648958 | C -> A | LOC_Os01g58194.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| vg0133648958 | C -> DEL | N | N | silent_mutation | Average:40.92; most accessible tissue: Zhenshan97 flag leaf, score: 82.529 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133648958 | NA | 1.37E-24 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 2.75E-07 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 6.62E-14 | 2.80E-139 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 2.97E-08 | 7.04E-15 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 6.19E-14 | 3.71E-137 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 3.28E-08 | 2.38E-14 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 6.79E-10 | 9.27E-88 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 1.80E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 6.67E-10 | 7.69E-90 | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 1.60E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 2.62E-22 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 2.36E-06 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 1.35E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 1.35E-06 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 1.41E-09 | 4.86E-131 | mr1008_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 1.36E-06 | 2.60E-14 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 1.06E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 6.71E-06 | 1.51E-96 | mr1015_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 9.01E-06 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 6.97E-09 | 2.15E-32 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | 1.83E-07 | 5.98E-09 | mr1051_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133648958 | NA | 1.69E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |