\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133643942:

Variant ID: vg0133643942 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33643942
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGCCTCCGTTGTTGTTGTTGTCGTTCACGGCACCTCCTCCTGGCGCACCAGCTCCGGATCCGGATCCAGCTCCTGTCGGCGGCGTACCACCTCCGCT[G/A]
GCAGTGGCGGCGGCAACTCCAGACATGGCGACGAGCAGTCGTGTGGGAGGCACTCCCCAAAAACCTGATCACCCGCCTACCCGGTGCAGATCTCAGGCGA

Reverse complement sequence

TCGCCTGAGATCTGCACCGGGTAGGCGGGTGATCAGGTTTTTGGGGAGTGCCTCCCACACGACTGCTCGTCGCCATGTCTGGAGTTGCCGCCGCCACTGC[C/T]
AGCGGAGGTGGTACGCCGCCGACAGGAGCTGGATCCGGATCCGGAGCTGGTGCGCCAGGAGGAGGTGCCGTGAACGACAACAACAACAACGGAGGCAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.20% 3.00% 17.96% 40.75% NA
All Indica  2759 6.00% 5.20% 22.73% 66.07% NA
All Japonica  1512 97.60% 0.00% 1.46% 0.93% NA
Aus  269 4.10% 0.00% 69.52% 26.39% NA
Indica I  595 7.40% 3.40% 7.23% 82.02% NA
Indica II  465 3.00% 6.00% 28.39% 62.58% NA
Indica III  913 3.90% 6.00% 30.67% 59.36% NA
Indica Intermediate  786 9.00% 5.20% 21.88% 63.87% NA
Temperate Japonica  767 96.30% 0.00% 2.74% 0.91% NA
Tropical Japonica  504 99.00% 0.00% 0.00% 0.99% NA
Japonica Intermediate  241 98.80% 0.00% 0.41% 0.83% NA
VI/Aromatic  96 95.80% 0.00% 3.12% 1.04% NA
Intermediate  90 70.00% 0.00% 11.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133643942 G -> A LOC_Os01g58170.1 upstream_gene_variant ; 4441.0bp to feature; MODIFIER silent_mutation Average:37.476; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0133643942 G -> A LOC_Os01g58194.1 intron_variant ; MODIFIER silent_mutation Average:37.476; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0133643942 G -> DEL N N silent_mutation Average:37.476; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133643942 5.02E-12 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 2.36E-09 3.23E-15 mr1008 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 3.46E-12 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 2.96E-09 1.33E-14 mr1009 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 2.98E-07 NA mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 8.88E-07 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 7.26E-09 NA mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 3.19E-07 5.06E-09 mr1015 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 3.51E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 1.12E-15 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 8.19E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 1.45E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 7.27E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 4.48E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 1.75E-06 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 5.97E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 9.65E-07 NA mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 9.02E-11 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 1.77E-06 NA mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 6.40E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133643942 NA 2.55E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251