\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133636638:

Variant ID: vg0133636638 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33636638
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, T: 0.32, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCGCGTCTCCCCTCTTGGTTTGCCTGTTCTTGCATTCTCTCATATTGTGCTTGAGCTTGTTTTTACCCGATCTACTTGCATGCTTATTTGATTTAGTT[T/G]
GTGACCTTATATCTTGCTTAGATACCTTATTTGTCACCTTTTGATTCATATACATTTTGTTTGTTTGAGCTACAAGTTCATAGCTAGTGTTTATTCCGTT

Reverse complement sequence

AACGGAATAAACACTAGCTATGAACTTGTAGCTCAAACAAACAAAATGTATATGAATCAAAAGGTGACAAATAAGGTATCTAAGCAAGATATAAGGTCAC[A/C]
AACTAAATCAAATAAGCATGCAAGTAGATCGGGTAAAAACAAGCTCAAGCACAATATGAGAGAATGCAAGAACAGGCAAACCAAGAGGGGAGACGCGCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.50% 37.20% 0.28% 0.00% NA
All Indica  2759 95.00% 4.70% 0.25% 0.00% NA
All Japonica  1512 2.50% 97.40% 0.07% 0.00% NA
Aus  269 97.00% 1.90% 1.12% 0.00% NA
Indica I  595 93.30% 6.60% 0.17% 0.00% NA
Indica II  465 97.80% 1.70% 0.43% 0.00% NA
Indica III  913 97.30% 2.60% 0.11% 0.00% NA
Indica Intermediate  786 92.10% 7.50% 0.38% 0.00% NA
Temperate Japonica  767 3.80% 96.10% 0.13% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 30.00% 67.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133636638 T -> G LOC_Os01g58160.1 downstream_gene_variant ; 1295.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0133636638 T -> G LOC_Os01g58170.1 downstream_gene_variant ; 1971.0bp to feature; MODIFIER silent_mutation Average:35.471; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0133636638 T -> G LOC_Os01g58160-LOC_Os01g58170 intergenic_region ; MODIFIER silent_mutation Average:35.471; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133636638 NA 1.54E-22 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 NA 6.09E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 1.49E-25 2.86E-154 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 1.27E-23 5.63E-149 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 3.96E-15 2.73E-94 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 1.40E-14 5.41E-95 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 NA 1.55E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 NA 3.90E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 NA 7.36E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 NA 3.96E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 7.41E-34 3.18E-162 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 2.30E-12 1.74E-11 mr1008_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 4.96E-18 1.91E-112 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 1.91E-08 1.91E-08 mr1015_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 4.56E-11 5.39E-86 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 NA 5.53E-29 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133636638 NA 4.60E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251