\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133616436:

Variant ID: vg0133616436 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 33616436
Reference Allele: TTCAlternative Allele: T,GTC
Primary Allele: GTCSecondary Allele: TTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGAAAAACGAGCAGCACGGTGACTGGAGGCGAGGGTGGCGGTGTTTGGGACGCAAATGTGTTGCACTCTGTTCTTGAATTGAGGTGTGATTATTTCAC[TTC/T,GTC]
AAAATTAAAAGTTTGGTTAAAATTGAAATAATGTGATAGAAAAGTTGGAAGTTTACGTGTGTAGGAAAGTTTTGATGTGATAGAAAAGTTGAAAGTTTAA

Reverse complement sequence

TTAAACTTTCAACTTTTCTATCACATCAAAACTTTCCTACACACGTAAACTTCCAACTTTTCTATCACATTATTTCAATTTTAACCAAACTTTTAATTTT[GAA/A,GAC]
GTGAAATAATCACACCTCAATTCAAGAACAGAGTGCAACACATTTGCGTCCCAAACACCGCCACCCTCGCCTCCAGTCACCGTGCTGCTCGTTTTTCACA

Allele Frequencies:

Populations Population SizeFrequency of GTC(primary allele) Frequency of TTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 37.10% 0.49% 2.86% T: 16.78%
All Indica  2759 62.40% 4.50% 0.83% 4.78% T: 27.47%
All Japonica  1512 1.40% 97.60% 0.00% 0.07% T: 0.99%
Aus  269 95.90% 1.50% 0.00% 0.74% T: 1.86%
Indica I  595 77.10% 6.20% 0.50% 2.35% T: 13.78%
Indica II  465 7.70% 1.50% 2.15% 14.41% T: 74.19%
Indica III  913 86.90% 2.50% 0.00% 0.88% T: 9.75%
Indica Intermediate  786 55.20% 7.30% 1.27% 5.47% T: 30.79%
Temperate Japonica  767 2.70% 96.30% 0.00% 0.13% T: 0.78%
Tropical Japonica  504 0.00% 99.00% 0.00% 0.00% T: 0.99%
Japonica Intermediate  241 0.00% 98.30% 0.00% 0.00% T: 1.66%
VI/Aromatic  96 4.20% 93.80% 0.00% 0.00% T: 2.08%
Intermediate  90 17.80% 67.80% 0.00% 0.00% T: 14.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133616436 TTC -> T LOC_Os01g58114.1 upstream_gene_variant ; 103.0bp to feature; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N
vg0133616436 TTC -> T LOC_Os01g58114.2 upstream_gene_variant ; 2040.0bp to feature; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N
vg0133616436 TTC -> T LOC_Os01g58130.1 downstream_gene_variant ; 1928.0bp to feature; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N
vg0133616436 TTC -> T LOC_Os01g58114-LOC_Os01g58130 intergenic_region ; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N
vg0133616436 TTC -> DEL N N silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N
vg0133616436 TTC -> GTC LOC_Os01g58114.1 upstream_gene_variant ; 102.0bp to feature; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N
vg0133616436 TTC -> GTC LOC_Os01g58114.2 upstream_gene_variant ; 2039.0bp to feature; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N
vg0133616436 TTC -> GTC LOC_Os01g58130.1 downstream_gene_variant ; 1929.0bp to feature; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N
vg0133616436 TTC -> GTC LOC_Os01g58114-LOC_Os01g58130 intergenic_region ; MODIFIER silent_mutation Average:94.585; most accessible tissue: Callus, score: 96.07 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0133616436 TTC GTC 0.01 0.02 0.01 0.01 0.0 -0.01
vg0133616436 TTC T 0.03 0.02 0.03 -0.06 -0.1 -0.13

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133616436 3.58E-07 1.01E-24 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 2.04E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 2.69E-39 3.61E-178 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 3.30E-38 8.63E-174 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 4.79E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 1.02E-18 4.35E-101 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 2.39E-19 2.84E-103 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 1.18E-57 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 3.97E-07 2.18E-74 mr1027 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 9.15E-07 6.26E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 1.86E-73 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 3.73E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 2.62E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 1.95E-23 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 2.30E-85 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 3.84E-91 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 2.34E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 1.90E-69 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 1.06E-10 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 2.60E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 5.43E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 1.88E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 6.91E-41 1.05E-174 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 4.96E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 7.77E-25 9.49E-122 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 7.51E-06 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 1.20E-12 1.02E-90 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 3.93E-08 5.49E-30 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 NA 1.68E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133616436 6.53E-08 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251