Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133600221:

Variant ID: vg0133600221 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 33600221
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TACTAACGGATTTTGTAATTAGTTTTTTTATTAGTGCCCGAACACCCTGTACGACACTATATATAATACCCGATGTGACACGCCAAAACTTTACACCCCT[A/G]
ATCTAAACACCCCCATAATTAGCGTGAGTCACGTGAAATAGAGGCATTTCATTTCAAAAAGAAAGGAAAGGAAGAATTATCTTCCAATCATCTATGCGTT

Reverse complement sequence

AACGCATAGATGATTGGAAGATAATTCTTCCTTTCCTTTCTTTTTGAAATGAAATGCCTCTATTTCACGTGACTCACGCTAATTATGGGGGTGTTTAGAT[T/C]
AGGGGTGTAAAGTTTTGGCGTGTCACATCGGGTATTATATATAGTGTCGTACAGGGTGTTCGGGCACTAATAAAAAAACTAATTACAAAATCCGTTAGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.50%	37.30%	18.73%	4.42%	NA
All Indica	2759	56.60%	4.70%	31.35%	7.36%	NA
All Japonica	1512	1.70%	97.60%	0.53%	0.13%	NA
Aus	269	96.30%	1.10%	1.86%	0.74%	NA
Indica I	595	41.30%	6.20%	45.71%	6.72%	NA
Indica II	465	57.20%	1.90%	33.33%	7.53%	NA
Indica III	913	68.60%	2.60%	20.48%	8.32%	NA
Indica Intermediate	786	53.90%	7.50%	31.93%	6.62%	NA
Temperate Japonica	767	2.90%	96.50%	0.39%	0.26%	NA
Tropical Japonica	504	0.60%	99.00%	0.40%	0.00%	NA
Japonica Intermediate	241	0.40%	98.30%	1.24%	0.00%	NA
VI/Aromatic	96	1.00%	97.90%	1.04%	0.00%	NA
Intermediate	90	22.20%	68.90%	6.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0133600221	A -> G	LOC_Os01g58080.1	downstream_gene_variant ; 2882.0bp to feature; MODIFIER	silent_mutation	Average:33.733; most accessible tissue: Callus, score: 62.756	N	N	N	N
vg0133600221	A -> G	LOC_Os01g58100.1	downstream_gene_variant ; 1109.0bp to feature; MODIFIER	silent_mutation	Average:33.733; most accessible tissue: Callus, score: 62.756	N	N	N	N
vg0133600221	A -> G	LOC_Os01g58080.2	downstream_gene_variant ; 3182.0bp to feature; MODIFIER	silent_mutation	Average:33.733; most accessible tissue: Callus, score: 62.756	N	N	N	N
vg0133600221	A -> G	LOC_Os01g58080.3	downstream_gene_variant ; 3168.0bp to feature; MODIFIER	silent_mutation	Average:33.733; most accessible tissue: Callus, score: 62.756	N	N	N	N
vg0133600221	A -> G	LOC_Os01g58080-LOC_Os01g58100	intergenic_region ; MODIFIER	silent_mutation	Average:33.733; most accessible tissue: Callus, score: 62.756	N	N	N	N
vg0133600221	A -> DEL	N	N	silent_mutation	Average:33.733; most accessible tissue: Callus, score: 62.756	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0133600221	NA	2.73E-23	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	9.91E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	2.41E-30	6.74E-168	mr1008	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	7.69E-29	1.69E-163	mr1009	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	7.20E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	4.98E-15	3.91E-97	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	2.84E-15	3.25E-99	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	1.97E-55	mr1019	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	2.36E-71	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	8.22E-22	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	1.17E-21	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	1.03E-86	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	2.04E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	4.39E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	3.75E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	1.64E-10	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	1.76E-38	2.83E-171	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	4.65E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	7.92E-23	3.87E-119	mr1015_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	9.67E-08	NA	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	1.63E-15	7.42E-93	mr1027_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	1.79E-06	4.30E-29	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	4.04E-26	mr1074_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	5.98E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	4.90E-18	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	NA	6.00E-94	mr1536_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221	7.49E-09	NA	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251