\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133600221:

Variant ID: vg0133600221 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33600221
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TACTAACGGATTTTGTAATTAGTTTTTTTATTAGTGCCCGAACACCCTGTACGACACTATATATAATACCCGATGTGACACGCCAAAACTTTACACCCCT[A/G]
ATCTAAACACCCCCATAATTAGCGTGAGTCACGTGAAATAGAGGCATTTCATTTCAAAAAGAAAGGAAAGGAAGAATTATCTTCCAATCATCTATGCGTT

Reverse complement sequence

AACGCATAGATGATTGGAAGATAATTCTTCCTTTCCTTTCTTTTTGAAATGAAATGCCTCTATTTCACGTGACTCACGCTAATTATGGGGGTGTTTAGAT[T/C]
AGGGGTGTAAAGTTTTGGCGTGTCACATCGGGTATTATATATAGTGTCGTACAGGGTGTTCGGGCACTAATAAAAAAACTAATTACAAAATCCGTTAGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.50% 37.30% 18.73% 4.42% NA
All Indica  2759 56.60% 4.70% 31.35% 7.36% NA
All Japonica  1512 1.70% 97.60% 0.53% 0.13% NA
Aus  269 96.30% 1.10% 1.86% 0.74% NA
Indica I  595 41.30% 6.20% 45.71% 6.72% NA
Indica II  465 57.20% 1.90% 33.33% 7.53% NA
Indica III  913 68.60% 2.60% 20.48% 8.32% NA
Indica Intermediate  786 53.90% 7.50% 31.93% 6.62% NA
Temperate Japonica  767 2.90% 96.50% 0.39% 0.26% NA
Tropical Japonica  504 0.60% 99.00% 0.40% 0.00% NA
Japonica Intermediate  241 0.40% 98.30% 1.24% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 22.20% 68.90% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133600221 A -> G LOC_Os01g58080.1 downstream_gene_variant ; 2882.0bp to feature; MODIFIER silent_mutation Average:33.733; most accessible tissue: Callus, score: 62.756 N N N N
vg0133600221 A -> G LOC_Os01g58100.1 downstream_gene_variant ; 1109.0bp to feature; MODIFIER silent_mutation Average:33.733; most accessible tissue: Callus, score: 62.756 N N N N
vg0133600221 A -> G LOC_Os01g58080.2 downstream_gene_variant ; 3182.0bp to feature; MODIFIER silent_mutation Average:33.733; most accessible tissue: Callus, score: 62.756 N N N N
vg0133600221 A -> G LOC_Os01g58080.3 downstream_gene_variant ; 3168.0bp to feature; MODIFIER silent_mutation Average:33.733; most accessible tissue: Callus, score: 62.756 N N N N
vg0133600221 A -> G LOC_Os01g58080-LOC_Os01g58100 intergenic_region ; MODIFIER silent_mutation Average:33.733; most accessible tissue: Callus, score: 62.756 N N N N
vg0133600221 A -> DEL N N silent_mutation Average:33.733; most accessible tissue: Callus, score: 62.756 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133600221 NA 2.73E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 9.91E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 2.41E-30 6.74E-168 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 7.69E-29 1.69E-163 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 7.20E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 4.98E-15 3.91E-97 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 2.84E-15 3.25E-99 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 1.97E-55 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 2.36E-71 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 8.22E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 1.17E-21 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 1.03E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 2.04E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 4.39E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 3.75E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 1.64E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 1.76E-38 2.83E-171 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 4.65E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 7.92E-23 3.87E-119 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 9.67E-08 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 1.63E-15 7.42E-93 mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 1.79E-06 4.30E-29 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 4.04E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 5.98E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 4.90E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 NA 6.00E-94 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133600221 7.49E-09 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251