| Variant ID: vg0133600221 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33600221 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 103. )
TACTAACGGATTTTGTAATTAGTTTTTTTATTAGTGCCCGAACACCCTGTACGACACTATATATAATACCCGATGTGACACGCCAAAACTTTACACCCCT[A/G]
ATCTAAACACCCCCATAATTAGCGTGAGTCACGTGAAATAGAGGCATTTCATTTCAAAAAGAAAGGAAAGGAAGAATTATCTTCCAATCATCTATGCGTT
AACGCATAGATGATTGGAAGATAATTCTTCCTTTCCTTTCTTTTTGAAATGAAATGCCTCTATTTCACGTGACTCACGCTAATTATGGGGGTGTTTAGAT[T/C]
AGGGGTGTAAAGTTTTGGCGTGTCACATCGGGTATTATATATAGTGTCGTACAGGGTGTTCGGGCACTAATAAAAAAACTAATTACAAAATCCGTTAGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.50% | 37.30% | 18.73% | 4.42% | NA |
| All Indica | 2759 | 56.60% | 4.70% | 31.35% | 7.36% | NA |
| All Japonica | 1512 | 1.70% | 97.60% | 0.53% | 0.13% | NA |
| Aus | 269 | 96.30% | 1.10% | 1.86% | 0.74% | NA |
| Indica I | 595 | 41.30% | 6.20% | 45.71% | 6.72% | NA |
| Indica II | 465 | 57.20% | 1.90% | 33.33% | 7.53% | NA |
| Indica III | 913 | 68.60% | 2.60% | 20.48% | 8.32% | NA |
| Indica Intermediate | 786 | 53.90% | 7.50% | 31.93% | 6.62% | NA |
| Temperate Japonica | 767 | 2.90% | 96.50% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 0.60% | 99.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 98.30% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 97.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 22.20% | 68.90% | 6.67% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133600221 | A -> G | LOC_Os01g58080.1 | downstream_gene_variant ; 2882.0bp to feature; MODIFIER | silent_mutation | Average:33.733; most accessible tissue: Callus, score: 62.756 | N | N | N | N |
| vg0133600221 | A -> G | LOC_Os01g58100.1 | downstream_gene_variant ; 1109.0bp to feature; MODIFIER | silent_mutation | Average:33.733; most accessible tissue: Callus, score: 62.756 | N | N | N | N |
| vg0133600221 | A -> G | LOC_Os01g58080.2 | downstream_gene_variant ; 3182.0bp to feature; MODIFIER | silent_mutation | Average:33.733; most accessible tissue: Callus, score: 62.756 | N | N | N | N |
| vg0133600221 | A -> G | LOC_Os01g58080.3 | downstream_gene_variant ; 3168.0bp to feature; MODIFIER | silent_mutation | Average:33.733; most accessible tissue: Callus, score: 62.756 | N | N | N | N |
| vg0133600221 | A -> G | LOC_Os01g58080-LOC_Os01g58100 | intergenic_region ; MODIFIER | silent_mutation | Average:33.733; most accessible tissue: Callus, score: 62.756 | N | N | N | N |
| vg0133600221 | A -> DEL | N | N | silent_mutation | Average:33.733; most accessible tissue: Callus, score: 62.756 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133600221 | NA | 2.73E-23 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | NA | 9.91E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | 2.41E-30 | 6.74E-168 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | 7.69E-29 | 1.69E-163 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | NA | 7.20E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | 4.98E-15 | 3.91E-97 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | 2.84E-15 | 3.25E-99 | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | NA | 1.97E-55 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | NA | 2.36E-71 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133600221 | NA | 8.22E-22 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/