\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133497043:

Variant ID: vg0133497043 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33497043
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTTTGTTCCACAAAAAATGTTTCACCTCATGTACTCACAATGTCTAATGTTGCAGTGAATGAAACATTTCATTGCAACAAAAAAACCCACATATTTT[G/A]
GAAACCCCATATTAAGGGACTTTGGTATATTTTTTGTTCCACCGAAAAATGTTATACCTAGTGTACTCACAATATTTCACTATGTATAGATCTAATGTTG

Reverse complement sequence

CAACATTAGATCTATACATAGTGAAATATTGTGAGTACACTAGGTATAACATTTTTCGGTGGAACAAAAAATATACCAAAGTCCCTTAATATGGGGTTTC[C/T]
AAAATATGTGGGTTTTTTTGTTGCAATGAAATGTTTCATTCACTGCAACATTAGACATTGTGAGTACATGAGGTGAAACATTTTTTGTGGAACAAAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 14.00% 4.53% 14.98% NA
All Indica  2759 43.80% 23.80% 6.92% 25.52% NA
All Japonica  1512 98.70% 0.00% 1.26% 0.07% NA
Aus  269 98.50% 0.70% 0.37% 0.37% NA
Indica I  595 23.40% 24.50% 9.58% 42.52% NA
Indica II  465 93.30% 2.40% 0.86% 3.44% NA
Indica III  913 24.60% 39.10% 8.54% 27.71% NA
Indica Intermediate  786 52.20% 18.10% 6.62% 23.16% NA
Temperate Japonica  767 97.40% 0.00% 2.48% 0.13% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 4.40% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133497043 G -> A LOC_Os01g57930.1 upstream_gene_variant ; 4084.0bp to feature; MODIFIER silent_mutation Average:25.302; most accessible tissue: Callus, score: 59.305 N N N N
vg0133497043 G -> A LOC_Os01g57942.1 upstream_gene_variant ; 1470.0bp to feature; MODIFIER silent_mutation Average:25.302; most accessible tissue: Callus, score: 59.305 N N N N
vg0133497043 G -> A LOC_Os01g57945.1 upstream_gene_variant ; 3108.0bp to feature; MODIFIER silent_mutation Average:25.302; most accessible tissue: Callus, score: 59.305 N N N N
vg0133497043 G -> A LOC_Os01g57940.1 downstream_gene_variant ; 350.0bp to feature; MODIFIER silent_mutation Average:25.302; most accessible tissue: Callus, score: 59.305 N N N N
vg0133497043 G -> A LOC_Os01g57946.1 downstream_gene_variant ; 3810.0bp to feature; MODIFIER silent_mutation Average:25.302; most accessible tissue: Callus, score: 59.305 N N N N
vg0133497043 G -> A LOC_Os01g57940-LOC_Os01g57942 intergenic_region ; MODIFIER silent_mutation Average:25.302; most accessible tissue: Callus, score: 59.305 N N N N
vg0133497043 G -> DEL N N silent_mutation Average:25.302; most accessible tissue: Callus, score: 59.305 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133497043 NA 1.39E-23 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0133497043 4.43E-08 NA mr1008 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 1.62E-07 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 7.24E-07 NA mr1014 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.44E-08 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 2.27E-06 NA mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 2.38E-07 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.48E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 8.93E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.17E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 4.35E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 3.05E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 3.15E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 2.07E-06 mr1274 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 4.11E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 3.83E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 3.30E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.31E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.42E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.86E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 2.90E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.79E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 5.89E-07 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.76E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 2.32E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.32E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 5.26E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.75E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 2.25E-10 NA mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 1.30E-08 NA mr1015_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 5.00E-06 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.44E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.76E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.31E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 2.66E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 8.76E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 5.58E-09 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 2.83E-11 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 2.29E-07 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 4.83E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.61E-07 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.94E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 2.14E-13 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.07E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 3.88E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 5.41E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 9.54E-14 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.61E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.92E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 5.90E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.92E-10 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.72E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.67E-10 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 7.34E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 8.25E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 4.95E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 6.75E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133497043 NA 1.54E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251