\
| Variant ID: vg0133479485 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33479485 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 340. )
AAATTCCGCTTTCTCAGCTTTGCCACTTTCAGTTTTTTGTGGGTCTCCATGAATGCTTGTTTGTGTCTCCACTTATCCAAAAATATTTTCAACTCTTGTG[C/A]
TTTCTCAATCACTTGCATTGCCATATCAAAAAATCCACCTTTGACTAAAGCATACAGAAATGCATCAATTAACTCATGGTTGAAATCAGCCCCCTTCCTC
GAGGAAGGGGGCTGATTTCAACCATGAGTTAATTGATGCATTTCTGTATGCTTTAGTCAAAGGTGGATTTTTTGATATGGCAATGCAAGTGATTGAGAAA[G/T]
CACAAGAGTTGAAAATATTTTTGGATAAGTGGAGACACAAACAAGCATTCATGGAGACCCACAAAAAACTGAAAGTGGCAAAGCTGAGAAAGCGGAATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.90% | 8.20% | 0.85% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 76.30% | 21.40% | 2.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.10% | 2.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 75.60% | 21.00% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 90.30% | 8.70% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.00% | 49.00% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133479485 | C -> A | LOC_Os01g57900.1 | missense_variant ; p.Ala620Ser; MODERATE | nonsynonymous_codon ; A620S | Average:42.996; most accessible tissue: Callus, score: 78.739 | benign |
1.247 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133479485 | 3.94E-07 | NA | mr1008 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133479485 | 1.34E-07 | NA | mr1009 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133479485 | 7.25E-06 | NA | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133479485 | NA | 3.67E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133479485 | NA | 2.80E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133479485 | NA | 5.93E-07 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133479485 | NA | 1.61E-06 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |