Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133471333:

Variant ID: vg0133471333 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33471333
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, C: 0.35, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTGGCGGAGTTCGTATATTCAAATTAAGCTGCTTTAGATTATAATCTGAAGCTGGGCCAAATATGGCCTTCCTCCTACTAACCTAGTTTATCGGTCG[C/G]
ATTGTTAAAACGGCTTTATATTTCATTCAACATCGGTGTCTGAAAATCATTTCGTACATGAGAAACTAAATTTGCACAATTTTCATTATCAACAGTTACT

Reverse complement sequence

AGTAACTGTTGATAATGAAAATTGTGCAAATTTAGTTTCTCATGTACGAAATGATTTTCAGACACCGATGTTGAATGAAATATAAAGCCGTTTTAACAAT[G/C]
CGACCGATAAACTAGGTTAGTAGGAGGAAGGCCATATTTGGCCCAGCTTCAGATTATAATCTAAAGCAGCTTAATTTGAATATACGAACTCCGCCAAATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 37.10% 0.02% 0.00% NA
All Indica  2759 95.50% 4.50% 0.00% 0.00% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 93.80% 6.20% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 7.10% 0.00% 0.00% NA
Temperate Japonica  767 3.50% 96.50% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 32.20% 66.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133471333 C -> G LOC_Os01g57890.1 upstream_gene_variant ; 567.0bp to feature; MODIFIER silent_mutation Average:30.342; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0133471333 C -> G LOC_Os01g57890.2 upstream_gene_variant ; 3562.0bp to feature; MODIFIER silent_mutation Average:30.342; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0133471333 C -> G LOC_Os01g57880.1 downstream_gene_variant ; 1341.0bp to feature; MODIFIER silent_mutation Average:30.342; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0133471333 C -> G LOC_Os01g57880-LOC_Os01g57890 intergenic_region ; MODIFIER silent_mutation Average:30.342; most accessible tissue: Minghui63 root, score: 52.955 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133471333 NA 1.80E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 5.78E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 2.86E-37 2.99E-175 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 6.70E-36 7.72E-171 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 6.87E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 8.58E-18 1.52E-99 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 9.72E-19 2.22E-102 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 1.77E-56 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 1.65E-06 2.21E-73 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 5.86E-22 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 4.50E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 6.01E-86 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 3.47E-89 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 1.57E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 1.30E-67 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 1.59E-81 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 5.88E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 4.76E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 1.33E-06 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 1.66E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 1.16E-98 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 2.09E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 1.34E-44 6.81E-179 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 NA 4.37E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 4.03E-26 1.90E-122 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 2.30E-07 1.09E-69 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 4.69E-15 1.44E-93 mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 1.42E-06 1.61E-29 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 1.87E-06 1.08E-95 mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 3.74E-06 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133471333 2.42E-08 7.15E-74 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251