| Variant ID: vg0133471333 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33471333 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, C: 0.35, others allele: 0.00, population size: 218. )
TATTTGGCGGAGTTCGTATATTCAAATTAAGCTGCTTTAGATTATAATCTGAAGCTGGGCCAAATATGGCCTTCCTCCTACTAACCTAGTTTATCGGTCG[C/G]
ATTGTTAAAACGGCTTTATATTTCATTCAACATCGGTGTCTGAAAATCATTTCGTACATGAGAAACTAAATTTGCACAATTTTCATTATCAACAGTTACT
AGTAACTGTTGATAATGAAAATTGTGCAAATTTAGTTTCTCATGTACGAAATGATTTTCAGACACCGATGTTGAATGAAATATAAAGCCGTTTTAACAAT[G/C]
CGACCGATAAACTAGGTTAGTAGGAGGAAGGCCATATTTGGCCCAGCTTCAGATTATAATCTAAAGCAGCTTAATTTGAATATACGAACTCCGCCAAATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.90% | 37.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 2.40% | 97.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.50% | 96.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 66.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133471333 | C -> G | LOC_Os01g57890.1 | upstream_gene_variant ; 567.0bp to feature; MODIFIER | silent_mutation | Average:30.342; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0133471333 | C -> G | LOC_Os01g57890.2 | upstream_gene_variant ; 3562.0bp to feature; MODIFIER | silent_mutation | Average:30.342; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0133471333 | C -> G | LOC_Os01g57880.1 | downstream_gene_variant ; 1341.0bp to feature; MODIFIER | silent_mutation | Average:30.342; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0133471333 | C -> G | LOC_Os01g57880-LOC_Os01g57890 | intergenic_region ; MODIFIER | silent_mutation | Average:30.342; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133471333 | NA | 1.80E-23 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | NA | 5.78E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | 2.86E-37 | 2.99E-175 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | 6.70E-36 | 7.72E-171 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | NA | 6.87E-13 | mr1010 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | 8.58E-18 | 1.52E-99 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | 9.72E-19 | 2.22E-102 | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | NA | 1.77E-56 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | 1.65E-06 | 2.21E-73 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133471333 | NA | 5.86E-22 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/