\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133439719:

Variant ID: vg0133439719 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33439719
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.57, C: 0.42, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAATTCCTTATAGATAAATGTGGGCAAAAGTCTGCCGCAAAGACTTTTGGTATCTTAGAGTTTATTAGAGATAATAGTCGTGTCCGGTATGGGCATAT[A/C]
TTGTAATTCTCAGGTATAAATAGACCCTGAGCCCTATGTAATTAACAACACACACGTTCAATATAATTTCGACGCATCGCCACCCTTTTGCTTTAGTTTT

Reverse complement sequence

AAAACTAAAGCAAAAGGGTGGCGATGCGTCGAAATTATATTGAACGTGTGTGTTGTTAATTACATAGGGCTCAGGGTCTATTTATACCTGAGAATTACAA[T/G]
ATATGCCCATACCGGACACGACTATTATCTCTAATAAACTCTAAGATACCAAAAGTCTTTGCGGCAGACTTTTGCCCACATTTATCTATAAGGAATTTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 37.20% 2.77% 1.97% NA
All Indica  2759 86.80% 5.30% 4.57% 3.26% NA
All Japonica  1512 3.60% 96.20% 0.00% 0.20% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 86.70% 7.20% 4.03% 2.02% NA
Indica II  465 87.30% 2.20% 6.02% 4.52% NA
Indica III  913 89.30% 3.20% 3.83% 3.72% NA
Indica Intermediate  786 83.80% 8.30% 4.96% 2.93% NA
Temperate Japonica  767 5.70% 94.10% 0.00% 0.13% NA
Tropical Japonica  504 0.80% 99.00% 0.00% 0.20% NA
Japonica Intermediate  241 2.50% 97.10% 0.00% 0.41% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 25.60% 70.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133439719 A -> DEL N N silent_mutation Average:24.593; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0133439719 A -> C LOC_Os01g57810.1 upstream_gene_variant ; 644.0bp to feature; MODIFIER silent_mutation Average:24.593; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0133439719 A -> C LOC_Os01g57830.1 upstream_gene_variant ; 3087.0bp to feature; MODIFIER silent_mutation Average:24.593; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0133439719 A -> C LOC_Os01g57800.1 downstream_gene_variant ; 4303.0bp to feature; MODIFIER silent_mutation Average:24.593; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N
vg0133439719 A -> C LOC_Os01g57810-LOC_Os01g57830 intergenic_region ; MODIFIER silent_mutation Average:24.593; most accessible tissue: Zhenshan97 flag leaf, score: 47.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133439719 NA 9.41E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 NA 1.04E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 1.68E-22 8.92E-149 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 1.04E-23 6.08E-148 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 3.67E-12 3.66E-89 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 1.35E-13 2.59E-92 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 9.29E-06 2.19E-68 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 NA 2.62E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 NA 3.53E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 1.42E-07 2.48E-08 mr1892 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 NA 1.90E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 6.94E-30 1.02E-156 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 7.51E-08 4.79E-08 mr1008_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 1.27E-16 6.57E-109 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 7.11E-06 7.11E-06 mr1015_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 5.15E-12 1.43E-87 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 NA 5.97E-06 mr1027_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 7.46E-06 2.28E-28 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133439719 8.90E-06 NA mr1536_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251