\
| Variant ID: vg0133434063 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33434063 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 113. )
TTAAACCATATGCGACCAATAATCAAGCTGAGTATGAAGCGGTGCTCAAGGGGTTGCAATTACTCAAGGAAGTTGAAGTTGATACCATTGAAATCATGGG[G/T]
GATTCTTTGCTGGTAATCAGTCAATTGGCATGAGAATATGAATGCAAGAACGATACGTTGATGGTTTATAATGAGAAGTGCTTGGAACTAATGAAAGAGT
ACTCTTTCATTAGTTCCAAGCACTTCTCATTATAAACCATCAACGTATCGTTCTTGCATTCATATTCTCATGCCAATTGACTGATTACCAGCAAAGAATC[C/A]
CCCATGATTTCAATGGTATCAACTTCAACTTCCTTGAGTAATTGCAACCCCTTGAGCACCGCTTCATACTCAGCTTGATTATTGGTCGCATATGGTTTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 43.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 91.30% | 8.50% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.20% | 65.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.20% | 0.43% | 0.00% | NA |
| Indica III | 913 | 90.60% | 9.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 22.20% | 76.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133434063 | G -> T | LOC_Os01g57800.1 | synonymous_variant ; p.Gly1372Gly; LOW | synonymous_codon | Average:26.885; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133434063 | NA | 3.46E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | 6.21E-06 | NA | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | NA | 2.60E-08 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | 1.33E-06 | NA | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | NA | 2.52E-08 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | NA | 4.67E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | NA | 2.55E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | NA | 3.41E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | 1.26E-07 | NA | mr1008_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | 5.50E-07 | 3.55E-12 | mr1008_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | 1.84E-06 | NA | mr1015_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133434063 | NA | 9.28E-07 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |