\
| Variant ID: vg0133425349 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33425349 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 107. )
GAGAGGAACCCAAAATACAAGAAAAATACCCCGAGGAGAAACCCGGGTCGCGTCCTCCGGCCCAGAGTAGTCAAAGGTTGGATGGGCTCGAGCCTGGAGC[G/A]
GCTGGAGCCGTCTAACAATGAAGTCGGCAGCGACTTCATATCCCGACAACCCCTGTACTCAGAGGTCATCAATGATATCGATGAAAGATTGGAGGGATGG
CCATCCCTCCAATCTTTCATCGATATCATTGATGACCTCTGAGTACAGGGGTTGTCGGGATATGAAGTCGCTGCCGACTTCATTGTTAGACGGCTCCAGC[C/T]
GCTCCAGGCTCGAGCCCATCCAACCTTTGACTACTCTGGGCCGGAGGACGCGACCCGGGTTTCTCCTCGGGGTATTTTTCTTGTATTTTGGGTTCCTCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 39.10% | 3.47% | 0.66% | NA |
| All Indica | 2759 | 92.40% | 6.80% | 0.80% | 0.04% | NA |
| All Japonica | 1512 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 34.90% | 2.20% | 52.04% | 10.78% | NA |
| Indica I | 595 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 92.20% | 7.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.10% | 8.30% | 2.54% | 0.13% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 25.60% | 71.10% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133425349 | G -> A | LOC_Os01g57800.1 | upstream_gene_variant ; 3252.0bp to feature; MODIFIER | silent_mutation | Average:55.808; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| vg0133425349 | G -> A | LOC_Os01g57780.1 | downstream_gene_variant ; 4987.0bp to feature; MODIFIER | silent_mutation | Average:55.808; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| vg0133425349 | G -> A | LOC_Os01g57790.1 | intron_variant ; MODIFIER | silent_mutation | Average:55.808; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| vg0133425349 | G -> DEL | N | N | silent_mutation | Average:55.808; most accessible tissue: Zhenshan97 flag leaf, score: 72.012 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133425349 | NA | 1.16E-24 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 1.31E-10 | NA | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 1.30E-09 | 6.18E-17 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 8.84E-12 | NA | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 1.12E-10 | 2.08E-17 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 9.10E-06 | mr1014 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 4.03E-06 | NA | mr1015 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 6.84E-06 | 1.84E-07 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 1.91E-23 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 2.45E-13 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 7.11E-08 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 4.93E-15 | mr1713 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 4.12E-28 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 1.96E-09 | NA | mr1008_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 1.54E-10 | 5.28E-19 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | 1.45E-06 | NA | mr1015_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 4.58E-08 | mr1015_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 2.39E-28 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 1.31E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 7.69E-14 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133425349 | NA | 3.00E-08 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |