\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133413972:

Variant ID: vg0133413972 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33413972
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTTTGTGTTGGATTGCGATGCGATGATTTGGGATTTGGAGAAGCAAAGCGAGGGTTGGGGGGGGGGTGCTTGGCTGCTCCCCTTTTCTTTTCCATCTC[T/C]
GATCCGATTTTTTTTTCCATCTCCGATCTGATTTTTTTTGCTTTTTTGCGCTGTTTCCAATTTGGGGGCGACATACAAAATTTTTTGGCTAAAACACCTT

Reverse complement sequence

AAGGTGTTTTAGCCAAAAAATTTTGTATGTCGCCCCCAAATTGGAAACAGCGCAAAAAAGCAAAAAAAATCAGATCGGAGATGGAAAAAAAAATCGGATC[A/G]
GAGATGGAAAAGAAAAGGGGAGCAGCCAAGCACCCCCCCCCCAACCCTCGCTTTGCTTCTCCAAATCCCAAATCATCGCATCGCAATCCAACACAAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 37.70% 5.63% 6.31% NA
All Indica  2759 81.30% 4.70% 9.46% 4.49% NA
All Japonica  1512 1.10% 98.90% 0.00% 0.00% NA
Aus  269 34.60% 1.90% 0.37% 63.20% NA
Indica I  595 69.10% 6.40% 23.03% 1.51% NA
Indica II  465 97.40% 1.70% 0.43% 0.43% NA
Indica III  913 80.90% 2.60% 7.23% 9.20% NA
Indica Intermediate  786 81.60% 7.60% 7.12% 3.69% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 24.40% 67.80% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133413972 T -> DEL N N silent_mutation Average:54.773; most accessible tissue: Minghui63 root, score: 82.967 N N N N
vg0133413972 T -> C LOC_Os01g57780.1 upstream_gene_variant ; 3173.0bp to feature; MODIFIER silent_mutation Average:54.773; most accessible tissue: Minghui63 root, score: 82.967 N N N N
vg0133413972 T -> C LOC_Os01g57770.1 intron_variant ; MODIFIER silent_mutation Average:54.773; most accessible tissue: Minghui63 root, score: 82.967 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133413972 1.64E-07 6.23E-27 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 2.35E-23 5.42E-149 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 1.18E-24 8.26E-147 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 8.77E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 4.20E-13 5.54E-87 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 6.65E-15 1.08E-89 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 5.70E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 3.12E-68 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 3.23E-06 5.13E-25 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 6.92E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 4.21E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 2.53E-91 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 9.39E-74 mr1538 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 1.55E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 3.51E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 3.51E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 4.60E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 1.89E-28 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 1.58E-07 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 2.47E-15 7.65E-141 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 3.63E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 2.62E-12 2.52E-103 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 1.24E-87 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 1.29E-07 4.62E-32 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 3.57E-75 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 5.69E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 1.48E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 8.75E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 1.57E-104 mr1538_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 4.71E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 4.72E-57 mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133413972 NA 4.49E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251