\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133257075:

Variant ID: vg0133257075 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33257075
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACTCCAACACTTGCTTAGCCCTTCTCCCTCAAAGAAAGCTCTGCCCTCGACAGGCAAAGGATGGTTAGATATTTATAGGCCGTGTTTAGATTTAATTT[G/T]
TTTTCTTTAAACTTTCAACTTTTCTGTCACATCAAATCTTTGGACACATGCATAGAGCATTAAATATGAATAAAAAAAATCAATTGCACAGTTTACATAT

Reverse complement sequence

ATATGTAAACTGTGCAATTGATTTTTTTTATTCATATTTAATGCTCTATGCATGTGTCCAAAGATTTGATGTGACAGAAAAGTTGAAAGTTTAAAGAAAA[C/A]
AAATTAAATCTAAACACGGCCTATAAATATCTAACCATCCTTTGCCTGTCGAGGGCAGAGCTTTCTTTGAGGGAGAAGGGCTAAGCAAGTGTTGGAGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 48.70% 0.06% 0.00% NA
All Indica  2759 30.00% 70.00% 0.07% 0.00% NA
All Japonica  1512 94.20% 5.70% 0.07% 0.00% NA
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 22.50% 77.30% 0.17% 0.00% NA
Indica II  465 74.40% 25.60% 0.00% 0.00% NA
Indica III  913 6.60% 93.30% 0.11% 0.00% NA
Indica Intermediate  786 36.50% 63.50% 0.00% 0.00% NA
Temperate Japonica  767 91.80% 8.20% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 2.00% 0.20% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133257075 G -> T LOC_Os01g57560.1 upstream_gene_variant ; 362.0bp to feature; MODIFIER silent_mutation Average:89.873; most accessible tissue: Zhenshan97 flag leaf, score: 96.541 N N N N
vg0133257075 G -> T LOC_Os01g57560-LOC_Os01g57570 intergenic_region ; MODIFIER silent_mutation Average:89.873; most accessible tissue: Zhenshan97 flag leaf, score: 96.541 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0133257075 G T 0.01 0.01 0.03 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133257075 NA 2.40E-06 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 NA 7.03E-12 mr1005 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 3.82E-14 1.10E-110 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 1.66E-20 3.06E-30 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 5.16E-14 1.95E-109 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 8.49E-21 4.08E-29 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 2.27E-10 2.51E-83 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 1.78E-07 9.04E-12 mr1014 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 4.26E-11 1.20E-86 mr1015 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 4.12E-10 1.02E-13 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 NA 2.98E-18 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 NA 2.27E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 NA 6.13E-15 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 NA 9.56E-10 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 1.51E-15 1.61E-112 mr1008_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 4.01E-19 1.26E-30 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 5.43E-09 3.45E-90 mr1015_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 5.07E-07 6.98E-13 mr1015_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 NA 1.81E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133257075 NA 6.61E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251