Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0133032292:

Variant ID: vg0133032292 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 33032292
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACTTAGACACTCGTATTAGCTTAAACTCGATCTAAAATAGAGTAAATTAAGCAAGGGACACCACACTACTAGAAAACTCATTTTCGGCGTCGTAGGGG[A/G]
TCGATTTTCGCAGGCGGGCATGTAATTCAGAGCCAAAACCCCGCCGGCAAAAAAAGTACCCGGGGTGGAGGGGGCGGTCCGCCTGCGAAGATTGATCTTT

Reverse complement sequence

AAAGATCAATCTTCGCAGGCGGACCGCCCCCTCCACCCCGGGTACTTTTTTTGCCGGCGGGGTTTTGGCTCTGAATTACATGCCCGCCTGCGAAAATCGA[T/C]
CCCCTACGACGCCGAAAATGAGTTTTCTAGTAGTGTGGTGTCCCTTGCTTAATTTACTCTATTTTAGATCGAGTTTAAGCTAATACGAGTGTCTAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.30% 15.80% 0.02% 0.89% NA
All Indica  2759 72.50% 26.00% 0.04% 1.52% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 81.30% 18.70% 0.00% 0.00% NA
Indica II  465 29.70% 69.90% 0.22% 0.22% NA
Indica III  913 91.50% 6.00% 0.00% 2.52% NA
Indica Intermediate  786 69.00% 28.80% 0.00% 2.29% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0133032292 A -> G LOC_Os01g57150.1 upstream_gene_variant ; 1803.0bp to feature; MODIFIER silent_mutation Average:64.71; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0133032292 A -> G LOC_Os01g57160.1 upstream_gene_variant ; 1311.0bp to feature; MODIFIER silent_mutation Average:64.71; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0133032292 A -> G LOC_Os01g57140.1 downstream_gene_variant ; 4965.0bp to feature; MODIFIER silent_mutation Average:64.71; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0133032292 A -> G LOC_Os01g57150-LOC_Os01g57160 intergenic_region ; MODIFIER silent_mutation Average:64.71; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0133032292 A -> DEL N N silent_mutation Average:64.71; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0133032292 NA 8.38E-19 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0133032292 NA 5.00E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 9.15E-07 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 6.89E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 3.83E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 4.32E-12 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 4.21E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 7.29E-14 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 4.94E-11 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 2.25E-16 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 4.46E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 7.95E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 2.19E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 1.57E-21 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 3.54E-10 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 1.92E-06 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 5.14E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 6.38E-10 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 2.26E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 7.27E-08 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 2.78E-06 mr1438_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 3.89E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 4.92E-15 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 8.84E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 3.87E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 1.86E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 1.07E-07 mr1994_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 1.41E-08 mr1994_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0133032292 NA 8.82E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251