Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132937128:

Variant ID: vg0132937128 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 32937128
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGGAGTTTTAAACTCTGGACCCTTCCAATGGGCCTCTGTGGGCCAATTCAGCGCAATAGGCTGACACAGAGAGGCCTCTCGTCAAGTCGAAAGACTAC[G/A]
CAGCCACAAATTATTCCACTCATCTTAGTCGTGCAAGCTTGATCGAATAGTCATAAGATATTCCACGGGGTTCGGAGTTCAAAACGATGACTCCCACTCC

Reverse complement sequence

GGAGTGGGAGTCATCGTTTTGAACTCCGAACCCCGTGGAATATCTTATGACTATTCGATCAAGCTTGCACGACTAAGATGAGTGGAATAATTTGTGGCTG[C/T]
GTAGTCTTTCGACTTGACGAGAGGCCTCTCTGTGTCAGCCTATTGCGCTGAATTGGCCCACAGAGGCCCATTGGAAGGGTCCAGAGTTTAAAACTCCAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.20%	13.50%	0.28%	0.00%	NA
All Indica	2759	84.60%	15.40%	0.00%	0.00%	NA
All Japonica	1512	96.60%	2.50%	0.86%	0.00%	NA
Aus	269	36.10%	63.90%	0.00%	0.00%	NA
Indica I	595	62.50%	37.50%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	91.70%	8.30%	0.00%	0.00%	NA
Indica Intermediate	786	84.50%	15.50%	0.00%	0.00%	NA
Temperate Japonica	767	93.90%	5.00%	1.17%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0132937128	G -> A	LOC_Os01g56990.1	upstream_gene_variant ; 4336.0bp to feature; MODIFIER	silent_mutation	Average:72.868; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0132937128	G -> A	LOC_Os01g57020.1	upstream_gene_variant ; 2829.0bp to feature; MODIFIER	silent_mutation	Average:72.868; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0132937128	G -> A	LOC_Os01g57004.1	downstream_gene_variant ; 2131.0bp to feature; MODIFIER	silent_mutation	Average:72.868; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N
vg0132937128	G -> A	LOC_Os01g57004-LOC_Os01g57020	intergenic_region ; MODIFIER	silent_mutation	Average:72.868; most accessible tissue: Zhenshan97 panicle, score: 86.058	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0132937128	G	A	0.06	0.05	0.05	0.01	0.02	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0132937128	NA	1.27E-16	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0132937128	NA	2.21E-14	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0132937128	NA	2.42E-06	mr1641	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	5.18E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	5.30E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	2.69E-09	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	1.09E-06	NA	mr1901	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	8.90E-08	mr1901	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	6.78E-06	mr1906	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	1.43E-08	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	1.76E-07	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	2.96E-06	mr1960	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	2.31E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	6.10E-07	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132937128	NA	2.99E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251