\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132864766:

Variant ID: vg0132864766 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32864766
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.35, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACATCAGATATATGGACACACATTTGAAATATTAAACGTAGTCTAATAAAAAAACTAATTACATAATCCATCAGTAAACCAGAAGACGAATTTATTA[A/G]
GCCTAATTAATCCGTCATTAGCAAATGTTTATTGTAGCACCACATTGTCAAATCATGAAACAATTAGGCTTAAAAAATTTGTCTCGCAAATTAGTCACAA

Reverse complement sequence

TTGTGACTAATTTGCGAGACAAATTTTTTAAGCCTAATTGTTTCATGATTTGACAATGTGGTGCTACAATAAACATTTGCTAATGACGGATTAATTAGGC[T/C]
TAATAAATTCGTCTTCTGGTTTACTGATGGATTATGTAATTAGTTTTTTTATTAGACTACGTTTAATATTTCAAATGTGTGTCCATATATCTGATGTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.10% 0.02% 0.00% NA
All Indica  2759 96.80% 3.10% 0.04% 0.00% NA
All Japonica  1512 0.60% 99.40% 0.00% 0.00% NA
Aus  269 45.00% 55.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.50% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.30% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 26.70% 73.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132864766 A -> G LOC_Os01g56910.1 upstream_gene_variant ; 4527.0bp to feature; MODIFIER silent_mutation Average:52.455; most accessible tissue: Callus, score: 76.667 N N N N
vg0132864766 A -> G LOC_Os01g56900.1 downstream_gene_variant ; 2119.0bp to feature; MODIFIER silent_mutation Average:52.455; most accessible tissue: Callus, score: 76.667 N N N N
vg0132864766 A -> G LOC_Os01g56900.2 downstream_gene_variant ; 1256.0bp to feature; MODIFIER silent_mutation Average:52.455; most accessible tissue: Callus, score: 76.667 N N N N
vg0132864766 A -> G LOC_Os01g56900-LOC_Os01g56910 intergenic_region ; MODIFIER silent_mutation Average:52.455; most accessible tissue: Callus, score: 76.667 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132864766 NA 1.65E-28 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 2.92E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 3.78E-09 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 1.04E-46 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 9.55E-55 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 5.09E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 3.56E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 4.04E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 1.08E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 7.09E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 6.95E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 4.48E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 7.42E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 1.25E-49 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 3.34E-06 2.38E-69 mr1558_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 1.59E-31 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 7.75E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766 NA 2.19E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251