Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132864766:

Variant ID: vg0132864766 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 32864766
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.35, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

GTCACATCAGATATATGGACACACATTTGAAATATTAAACGTAGTCTAATAAAAAAACTAATTACATAATCCATCAGTAAACCAGAAGACGAATTTATTA[A/G]
GCCTAATTAATCCGTCATTAGCAAATGTTTATTGTAGCACCACATTGTCAAATCATGAAACAATTAGGCTTAAAAAATTTGTCTCGCAAATTAGTCACAA

Reverse complement sequence

TTGTGACTAATTTGCGAGACAAATTTTTTAAGCCTAATTGTTTCATGATTTGACAATGTGGTGCTACAATAAACATTTGCTAATGACGGATTAATTAGGC[T/C]
TAATAAATTCGTCTTCTGGTTTACTGATGGATTATGTAATTAGTTTTTTTATTAGACTACGTTTAATATTTCAAATGTGTGTCCATATATCTGATGTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	40.10%	0.02%	0.00%	NA
All Indica	2759	96.80%	3.10%	0.04%	0.00%	NA
All Japonica	1512	0.60%	99.40%	0.00%	0.00%	NA
Aus	269	45.00%	55.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.50%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	92.70%	7.30%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	26.70%	73.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0132864766	A -> G	LOC_Os01g56910.1	upstream_gene_variant ; 4527.0bp to feature; MODIFIER	silent_mutation	Average:52.455; most accessible tissue: Callus, score: 76.667	N	N	N	N
vg0132864766	A -> G	LOC_Os01g56900.1	downstream_gene_variant ; 2119.0bp to feature; MODIFIER	silent_mutation	Average:52.455; most accessible tissue: Callus, score: 76.667	N	N	N	N
vg0132864766	A -> G	LOC_Os01g56900.2	downstream_gene_variant ; 1256.0bp to feature; MODIFIER	silent_mutation	Average:52.455; most accessible tissue: Callus, score: 76.667	N	N	N	N
vg0132864766	A -> G	LOC_Os01g56900-LOC_Os01g56910	intergenic_region ; MODIFIER	silent_mutation	Average:52.455; most accessible tissue: Callus, score: 76.667	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0132864766	NA	1.65E-28	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	2.92E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	3.78E-09	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	1.04E-46	mr1509	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	9.55E-55	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	5.09E-23	mr1571	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	3.56E-21	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	4.04E-12	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	1.08E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	7.09E-29	mr1793	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	6.95E-18	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	4.48E-25	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	7.42E-16	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	1.25E-49	mr1509_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	3.34E-06	2.38E-69	mr1558_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	1.59E-31	mr1571_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	7.75E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132864766	NA	2.19E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251