Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0132861439:

Variant ID: vg0132861439 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32861439
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTACAGGCCGCGCGCCCATCGGCTAGATCTGCTCCCGAACCCGCACCCCGTGTACCTCCACGACTCTATGACTGCCCTCCTCAGCCGCCAAGACGGCGC[C/T]
TGGTATGCAGTCGCCGCCCTGGGTCTTGGCCCCCCGGTGTACAAAGGCGGTGCGCCCGTTAGCTGGGATTTCTACCTCCACCTCTACAGATCCACCTCCA

Reverse complement sequence

TGGAGGTGGATCTGTAGAGGTGGAGGTAGAAATCCCAGCTAACGGGCGCACCGCCTTTGTACACCGGGGGGCCAAGACCCAGGGCGGCGACTGCATACCA[G/A]
GCGCCGTCTTGGCGGCTGAGGAGGGCAGTCATAGAGTCGTGGAGGTACACGGGGTGCGGGTTCGGGAGCAGATCTAGCCGATGGGCGCGCGGCCTGTAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.30% 0.23% 0.00% NA
All Indica  2759 96.20% 3.50% 0.36% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 97.60% 1.30% 1.01% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.00% 1.50% 0.44% 0.00% NA
Indica Intermediate  786 91.60% 8.40% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 25.60% 73.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132861439 C -> T LOC_Os01g56900.1 synonymous_variant ; p.Ala152Ala; LOW synonymous_codon Average:95.796; most accessible tissue: Minghui63 flower, score: 98.422 N N N N
vg0132861439 C -> T LOC_Os01g56900.2 synonymous_variant ; p.Ala152Ala; LOW synonymous_codon Average:95.796; most accessible tissue: Minghui63 flower, score: 98.422 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0132861439 C T -0.02 -0.02 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132861439 NA 2.23E-23 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 8.14E-06 NA mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 4.13E-06 NA mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 5.95E-28 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.75E-26 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.04E-23 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.46E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.79E-50 mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.17E-63 mr1088 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.43E-52 mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 7.90E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.01E-38 mr1139 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.30E-10 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 7.48E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.82E-15 mr1199 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.24E-64 mr1246 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.05E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.05E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.83E-09 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 6.30E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.57E-42 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.11E-41 mr1509 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.59E-25 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 9.46E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.30E-48 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.87E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.09E-12 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.46E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 5.46E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 5.95E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.69E-30 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.42E-31 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.98E-33 mr1793 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.50E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.78E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.11E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.16E-30 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 5.85E-26 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.10E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.69E-63 mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.41E-75 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.12E-60 mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.01E-61 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.29E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 5.32E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.28E-74 mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 5.23E-48 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.57E-50 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.42E-67 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.99E-34 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 1.70E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.97E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 4.64E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 3.64E-49 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.14E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 5.52E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132861439 NA 2.29E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251