\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132526029:

Variant ID: vg0132526029 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32526029
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GCGCACCTGTTCAGTTATACTAATCCATACTTATAAAGGAAATCATTTAGGACAATGTTTAAGTCAAACCTTAGAAATATAAATCATGAATAACTCTCAA[A/G]
TTGTTGAGTTTGAAAATATAAAAATTATATATATAGATTTATCTTGAAAAATACTTTCATAAAAGTTTACATATAGCACTTTTCAATAAATATTTTTATA

Reverse complement sequence

TATAAAAATATTTATTGAAAAGTGCTATATGTAAACTTTTATGAAAGTATTTTTCAAGATAAATCTATATATATAATTTTTATATTTTCAAACTCAACAA[T/C]
TTGAGAGTTATTCATGATTTATATTTCTAAGGTTTGACTTAAACATTGTCCTAAATGATTTCCTTTATAAGTATGGATTAGTATAACTGAACAGGTGCGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.40% 28.40% 7.11% 2.07% NA
All Indica  2759 82.90% 2.00% 11.67% 3.37% NA
All Japonica  1512 25.40% 73.70% 0.60% 0.33% NA
Aus  269 87.00% 12.30% 0.74% 0.00% NA
Indica I  595 82.90% 0.00% 14.45% 2.69% NA
Indica II  465 75.50% 2.80% 16.34% 5.38% NA
Indica III  913 86.40% 2.10% 7.89% 3.61% NA
Indica Intermediate  786 83.30% 3.10% 11.20% 2.42% NA
Temperate Japonica  767 0.90% 99.00% 0.13% 0.00% NA
Tropical Japonica  504 71.80% 26.00% 1.39% 0.79% NA
Japonica Intermediate  241 6.20% 92.90% 0.41% 0.41% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 43.30% 53.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132526029 A -> G LOC_Os01g56430.1 upstream_gene_variant ; 261.0bp to feature; MODIFIER silent_mutation Average:76.556; most accessible tissue: Callus, score: 97.792 N N N N
vg0132526029 A -> G LOC_Os01g56410.1 downstream_gene_variant ; 4022.0bp to feature; MODIFIER silent_mutation Average:76.556; most accessible tissue: Callus, score: 97.792 N N N N
vg0132526029 A -> G LOC_Os01g56420.1 downstream_gene_variant ; 1846.0bp to feature; MODIFIER silent_mutation Average:76.556; most accessible tissue: Callus, score: 97.792 N N N N
vg0132526029 A -> G LOC_Os01g56420-LOC_Os01g56430 intergenic_region ; MODIFIER silent_mutation Average:76.556; most accessible tissue: Callus, score: 97.792 N N N N
vg0132526029 A -> DEL N N silent_mutation Average:76.556; most accessible tissue: Callus, score: 97.792 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132526029 NA 7.77E-22 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.76E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.08E-15 mr1401 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 2.42E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.93E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 2.12E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.11E-37 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 7.52E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.42E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.35E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 2.75E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 5.60E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 5.20E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 7.11E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.14E-08 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 4.24E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 6.73E-06 NA mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 2.41E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 8.34E-06 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 4.87E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.59E-23 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.02E-07 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.17E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 4.97E-38 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 2.04E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 2.86E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 2.34E-06 6.34E-16 mr1770_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.44E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 9.85E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.26E-28 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.91E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 1.87E-15 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132526029 NA 3.81E-39 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251