\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132480676:

Variant ID: vg0132480676 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32480676
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAACGGAGATTTTATTATGGCCCTCTTTATTTAGGCTTAGGTTTATTGGCCTAGACTTTTAAGTTAACTTATTGGCTTATATGATTTATAAGACAATG[G/A]
ATTTAATGTCCTAAGTTTAGTGGTTGAGTCATACATCTACCTCACATAAGCCAAAAAAGCTTCTCCAACCTAGCTTTTGGCTTAATAGTGTTAAAGTGGC

Reverse complement sequence

GCCACTTTAACACTATTAAGCCAAAAGCTAGGTTGGAGAAGCTTTTTTGGCTTATGTGAGGTAGATGTATGACTCAACCACTAAACTTAGGACATTAAAT[C/T]
CATTGTCTTATAAATCATATAAGCCAATAAGTTAACTTAAAAGTCTAGGCCAATAAACCTAAGCCTAAATAAAGAGGGCCATAATAAAATCTCCGTTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 15.30% 0.32% 11.32% NA
All Indica  2759 98.90% 0.80% 0.00% 0.29% NA
All Japonica  1512 27.10% 44.70% 0.40% 27.84% NA
Aus  269 89.60% 0.70% 0.00% 9.67% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.20% 0.20% 0.00% 0.55% NA
Indica Intermediate  786 97.80% 1.80% 0.00% 0.38% NA
Temperate Japonica  767 0.90% 75.10% 0.13% 23.86% NA
Tropical Japonica  504 76.00% 5.00% 0.20% 18.85% NA
Japonica Intermediate  241 7.90% 31.10% 1.66% 59.34% NA
VI/Aromatic  96 26.00% 0.00% 5.21% 68.75% NA
Intermediate  90 56.70% 23.30% 4.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132480676 G -> A LOC_Os01g56360.1 upstream_gene_variant ; 1528.0bp to feature; MODIFIER silent_mutation Average:72.409; most accessible tissue: Zhenshan97 flag leaf, score: 88.363 N N N N
vg0132480676 G -> A LOC_Os01g56350.1 downstream_gene_variant ; 4037.0bp to feature; MODIFIER silent_mutation Average:72.409; most accessible tissue: Zhenshan97 flag leaf, score: 88.363 N N N N
vg0132480676 G -> A LOC_Os01g56370.1 downstream_gene_variant ; 4060.0bp to feature; MODIFIER silent_mutation Average:72.409; most accessible tissue: Zhenshan97 flag leaf, score: 88.363 N N N N
vg0132480676 G -> A LOC_Os01g56350.2 downstream_gene_variant ; 4037.0bp to feature; MODIFIER silent_mutation Average:72.409; most accessible tissue: Zhenshan97 flag leaf, score: 88.363 N N N N
vg0132480676 G -> A LOC_Os01g56350.3 downstream_gene_variant ; 4037.0bp to feature; MODIFIER silent_mutation Average:72.409; most accessible tissue: Zhenshan97 flag leaf, score: 88.363 N N N N
vg0132480676 G -> A LOC_Os01g56360-LOC_Os01g56370 intergenic_region ; MODIFIER silent_mutation Average:72.409; most accessible tissue: Zhenshan97 flag leaf, score: 88.363 N N N N
vg0132480676 G -> DEL N N silent_mutation Average:72.409; most accessible tissue: Zhenshan97 flag leaf, score: 88.363 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0132480676 G A 0.01 0.02 0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132480676 NA 2.20E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 5.14E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 1.18E-22 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 3.24E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 8.31E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 2.04E-20 mr1422 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 2.94E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 7.13E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 4.57E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 7.64E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 1.62E-20 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 7.22E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 5.90E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 1.95E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 2.58E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 9.51E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 5.66E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 4.14E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132480676 NA 8.37E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251