\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132416363:

Variant ID: vg0132416363 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32416363
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TGCGATACGAGTATTTGCCCGCCATTTGCCGCATACGACCAATGTAACTTTCGGCGCCAATCAGGCGTACCCACCATGCCCCGCCACATTCAAATGTCAG[G/A]
GATATCACTCGATTTTTGGTGCCTATATAAGTTGCCTTAACGAGCGAGGCCTCACAATCTTTCAGAACTCAGTCACATTCAGTACTCTCTTCCCCACTTG

Reverse complement sequence

CAAGTGGGGAAGAGAGTACTGAATGTGACTGAGTTCTGAAAGATTGTGAGGCCTCGCTCGTTAAGGCAACTTATATAGGCACCAAAAATCGAGTGATATC[C/T]
CTGACATTTGAATGTGGCGGGGCATGGTGGGTACGCCTGATTGGCGCCGAAAGTTACATTGGTCGTATGCGGCAAATGGCGGGCAAATACTCGTATCGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 47.10% 1.52% 0.00% NA
All Indica  2759 25.50% 74.00% 0.54% 0.00% NA
All Japonica  1512 99.40% 0.50% 0.07% 0.00% NA
Aus  269 24.50% 55.40% 20.07% 0.00% NA
Indica I  595 3.40% 96.60% 0.00% 0.00% NA
Indica II  465 6.20% 93.50% 0.22% 0.00% NA
Indica III  913 46.70% 52.90% 0.44% 0.00% NA
Indica Intermediate  786 29.00% 69.70% 1.27% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 73.30% 24.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132416363 G -> A LOC_Os01g56270.1 downstream_gene_variant ; 2728.0bp to feature; MODIFIER silent_mutation Average:35.976; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0132416363 G -> A LOC_Os01g56270.2 downstream_gene_variant ; 2764.0bp to feature; MODIFIER silent_mutation Average:35.976; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0132416363 G -> A LOC_Os01g56280.1 intron_variant ; MODIFIER silent_mutation Average:35.976; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132416363 NA 1.68E-08 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 7.49E-07 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 9.87E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 1.10E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 8.64E-32 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 3.15E-10 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 5.17E-09 mr1234 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 1.55E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 5.11E-07 5.11E-07 mr1340 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 2.29E-06 2.29E-06 mr1429 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 1.26E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 3.44E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 4.22E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 1.13E-06 1.13E-06 mr1964 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 6.47E-08 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 3.81E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 1.71E-07 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 2.84E-09 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 3.52E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132416363 NA 1.41E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251