\
| Variant ID: vg0132416363 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 32416363 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 263. )
TGCGATACGAGTATTTGCCCGCCATTTGCCGCATACGACCAATGTAACTTTCGGCGCCAATCAGGCGTACCCACCATGCCCCGCCACATTCAAATGTCAG[G/A]
GATATCACTCGATTTTTGGTGCCTATATAAGTTGCCTTAACGAGCGAGGCCTCACAATCTTTCAGAACTCAGTCACATTCAGTACTCTCTTCCCCACTTG
CAAGTGGGGAAGAGAGTACTGAATGTGACTGAGTTCTGAAAGATTGTGAGGCCTCGCTCGTTAAGGCAACTTATATAGGCACCAAAAATCGAGTGATATC[C/T]
CTGACATTTGAATGTGGCGGGGCATGGTGGGTACGCCTGATTGGCGCCGAAAGTTACATTGGTCGTATGCGGCAAATGGCGGGCAAATACTCGTATCGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 47.10% | 1.52% | 0.00% | NA |
| All Indica | 2759 | 25.50% | 74.00% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 24.50% | 55.40% | 20.07% | 0.00% | NA |
| Indica I | 595 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 6.20% | 93.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 46.70% | 52.90% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 29.00% | 69.70% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 24.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0132416363 | G -> A | LOC_Os01g56270.1 | downstream_gene_variant ; 2728.0bp to feature; MODIFIER | silent_mutation | Average:35.976; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg0132416363 | G -> A | LOC_Os01g56270.2 | downstream_gene_variant ; 2764.0bp to feature; MODIFIER | silent_mutation | Average:35.976; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg0132416363 | G -> A | LOC_Os01g56280.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.976; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0132416363 | NA | 1.68E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 7.49E-07 | mr1144 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 9.87E-23 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 1.10E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 8.64E-32 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 3.15E-10 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 5.17E-09 | mr1234 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 1.55E-08 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | 5.11E-07 | 5.11E-07 | mr1340 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | 2.29E-06 | 2.29E-06 | mr1429 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 1.26E-06 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 3.44E-06 | mr1590 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 4.22E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | 1.13E-06 | 1.13E-06 | mr1964 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 6.47E-08 | mr1078_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 3.81E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 1.71E-07 | mr1200_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 2.84E-09 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 3.52E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132416363 | NA | 1.41E-06 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |