| Variant ID: vg0132413637 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 32413637 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTGGGTTATGTGATCTCTCTAGCATCTTGTTTTTTACCATATTACTGAAATGATTATTCTTTCATATTGCCGAAATGATTATTCTTCCATTTTTTTTCTA[A/T]
GTTCATGATGTAAGACAAAAAGATTCCGTGCAAATACCTCAGCTACATTGTAGCAATTTTGTGATTAAATATTTTTATACACATGTCATGGATCAGACTC
GAGTCTGATCCATGACATGTGTATAAAAATATTTAATCACAAAATTGCTACAATGTAGCTGAGGTATTTGCACGGAATCTTTTTGTCTTACATCATGAAC[T/A]
TAGAAAAAAAATGGAAGAATAATCATTTCGGCAATATGAAAGAATAATCATTTCAGTAATATGGTAAAAAACAAGATGCTAGAGAGATCACATAACCCAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.60% | 2.30% | 0.70% | 3.36% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 80.50% | 7.10% | 2.05% | 10.38% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.70% | 0.30% | 0.00% | 4.04% | NA |
| Tropical Japonica | 504 | 51.60% | 20.20% | 6.15% | 22.02% | NA |
| Japonica Intermediate | 241 | 92.50% | 1.20% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0132413637 | A -> T | LOC_Os01g56280.1 | upstream_gene_variant ; 1438.0bp to feature; MODIFIER | silent_mutation | Average:34.237; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0132413637 | A -> T | LOC_Os01g56270.1 | downstream_gene_variant ; 2.0bp to feature; MODIFIER | silent_mutation | Average:34.237; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0132413637 | A -> T | LOC_Os01g56270.2 | downstream_gene_variant ; 38.0bp to feature; MODIFIER | silent_mutation | Average:34.237; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0132413637 | A -> T | LOC_Os01g56270-LOC_Os01g56280 | intergenic_region ; MODIFIER | silent_mutation | Average:34.237; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0132413637 | A -> DEL | N | N | silent_mutation | Average:34.237; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0132413637 | NA | 1.16E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132413637 | 3.03E-06 | 8.00E-06 | mr1296 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132413637 | NA | 1.45E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |