\
| Variant ID: vg0132411125 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 32411125 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 113. )
TTCCAGATGGATATGCAGAAAACATCTCAAAATGTATAAATGTTAGTCAAGGGAAAATTTCAGGTCTTAAAAGTCATGACTGTCATATTCTAATGCAAGA[A/T]
CTTCTCCCAGTTGCTTTGCGGGGTGTGCTTCCTTACAATGTCACTTTTGTCTTATTTGATCTATGTGGATATTTTAGAGAACTGAGTTCAAAAGTCCTGT
ACAGGACTTTTGAACTCAGTTCTCTAAAATATCCACATAGATCAAATAAGACAAAAGTGACATTGTAAGGAAGCACACCCCGCAAAGCAACTGGGAGAAG[T/A]
TCTTGCATTAGAATATGACAGTCATGACTTTTAAGACCTGAAATTTTCCCTTGACTAACATTTATACATTTTGAGATGTTTTCTGCATATCCATCTGGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.70% | 7.00% | 14.26% | 5.04% | NA |
| All Indica | 2759 | 64.60% | 11.20% | 20.44% | 3.77% | NA |
| All Japonica | 1512 | 87.30% | 0.30% | 3.51% | 8.86% | NA |
| Aus | 269 | 79.60% | 3.00% | 17.47% | 0.00% | NA |
| Indica I | 595 | 69.40% | 5.90% | 21.01% | 3.70% | NA |
| Indica II | 465 | 53.30% | 12.90% | 28.17% | 5.59% | NA |
| Indica III | 913 | 64.50% | 15.70% | 16.43% | 3.40% | NA |
| Indica Intermediate | 786 | 67.60% | 9.20% | 20.10% | 3.18% | NA |
| Temperate Japonica | 767 | 99.20% | 0.00% | 0.00% | 0.78% | NA |
| Tropical Japonica | 504 | 65.50% | 0.20% | 10.12% | 24.21% | NA |
| Japonica Intermediate | 241 | 95.00% | 1.70% | 0.83% | 2.49% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 6.70% | 11.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0132411125 | A -> T | LOC_Os01g56280.1 | upstream_gene_variant ; 3950.0bp to feature; MODIFIER | silent_mutation | Average:13.952; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0132411125 | A -> T | LOC_Os01g56270.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.952; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0132411125 | A -> T | LOC_Os01g56270.2 | intron_variant ; MODIFIER | silent_mutation | Average:13.952; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0132411125 | A -> DEL | N | N | silent_mutation | Average:13.952; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0132411125 | NA | 1.61E-06 | mr1236 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132411125 | 6.62E-06 | 3.77E-07 | mr1236 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132411125 | NA | 8.26E-06 | mr1785 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132411125 | 8.40E-06 | 4.69E-06 | mr1816 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132411125 | 5.19E-06 | 5.19E-06 | mr1854 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |