Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132410982:

Variant ID: vg0132410982 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 32410982
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

CTTGGACCTACAAGAAATGAATATAAGGCCAGATTTGCATCCCATAAGAAAAGCTAATAATAAGTATTATTTGCCTCCTGCTTCCTATACAATGTCTAAA[C/T]
GGGAGAAACATCAATTTTGCAAAGTTCTCCATGATATTAAGGTTCCAGATGGATATGCAGAAAACATCTCAAAATGTATAAATGTTAGTCAAGGGAAAAT

Reverse complement sequence

ATTTTCCCTTGACTAACATTTATACATTTTGAGATGTTTTCTGCATATCCATCTGGAACCTTAATATCATGGAGAACTTTGCAAAATTGATGTTTCTCCC[G/A]
TTTAGACATTGTATAGGAAGCAGGAGGCAAATAATACTTATTATTAGCTTTTCTTATGGGATGCAAATCTGGCCTTATATTCATTTCTTGTAGGTCCAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.20%	2.60%	0.91%	4.25%	NA
All Indica	2759	97.70%	0.30%	0.51%	1.49%	NA
All Japonica	1512	80.70%	7.10%	1.65%	10.52%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.00%	0.22%	0.65%	NA
Indica III	913	94.70%	0.40%	1.20%	3.61%	NA
Indica Intermediate	786	98.60%	0.50%	0.25%	0.64%	NA
Temperate Japonica	767	95.70%	0.40%	0.00%	3.91%	NA
Tropical Japonica	504	52.20%	20.20%	4.96%	22.62%	NA
Japonica Intermediate	241	92.50%	1.20%	0.00%	6.22%	NA
VI/Aromatic	96	94.80%	3.10%	2.08%	0.00%	NA
Intermediate	90	92.20%	4.40%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0132410982	C -> T	LOC_Os01g56280.1	upstream_gene_variant ; 4093.0bp to feature; MODIFIER	silent_mutation	Average:16.201; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0132410982	C -> T	LOC_Os01g56270.1	intron_variant ; MODIFIER	silent_mutation	Average:16.201; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0132410982	C -> T	LOC_Os01g56270.2	intron_variant ; MODIFIER	silent_mutation	Average:16.201; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg0132410982	C -> DEL	N	N	silent_mutation	Average:16.201; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0132410982	NA	8.60E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132410982	6.99E-06	NA	mr1296	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132410982	NA	1.87E-06	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132410982	2.26E-06	2.26E-06	mr1333_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132410982	NA	3.48E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132410982	NA	6.33E-06	mr1686_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132410982	NA	1.27E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251