\
| Variant ID: vg0132377418 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 32377418 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATGTGGCGCGCCTGCAACTTCACCTTCATCACCATCGCCCACTCGGCGTAGTTAGTCTTGGTGAGCATGGGCCATGCGCCGCCAACATCCTTGACGAC[G/A]
ATCTGCACAACGGGAGGAGAGCCGGAGCGTCCACGGCGACCACGGCGCCGGTCCGGGGAAGGGGAGGCGCGCTGCCTGCGAGGGCTCCGTGCGCCAACGT
ACGTTGGCGCACGGAGCCCTCGCAGGCAGCGCGCCTCCCCTTCCCCGGACCGGCGCCGTGGTCGCCGTGGACGCTCCGGCTCTCCTCCCGTTGTGCAGAT[C/T]
GTCGTCAAGGATGTTGGCGGCGCATGGCCCATGCTCACCAAGACTAACTACGCCGAGTGGGCGATGGTGATGAAGGTGAAGTTGCAGGCGCGCCACATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.10% | 3.30% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 88.00% | 10.30% | 1.72% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.70% | 3.70% | 2.61% | 0.00% | NA |
| Tropical Japonica | 504 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.10% | 39.40% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0132377418 | G -> A | LOC_Os01g56210.1 | upstream_gene_variant ; 4549.0bp to feature; MODIFIER | silent_mutation | Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0132377418 | G -> A | LOC_Os01g56220.1 | downstream_gene_variant ; 2342.0bp to feature; MODIFIER | silent_mutation | Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0132377418 | G -> A | LOC_Os01g56230.1 | downstream_gene_variant ; 3792.0bp to feature; MODIFIER | silent_mutation | Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0132377418 | G -> A | LOC_Os01g56230.2 | downstream_gene_variant ; 3792.0bp to feature; MODIFIER | silent_mutation | Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0132377418 | G -> A | LOC_Os01g56230.3 | downstream_gene_variant ; 3792.0bp to feature; MODIFIER | silent_mutation | Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0132377418 | G -> A | LOC_Os01g56230.4 | downstream_gene_variant ; 3792.0bp to feature; MODIFIER | silent_mutation | Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0132377418 | G -> A | LOC_Os01g56230.5 | downstream_gene_variant ; 3792.0bp to feature; MODIFIER | silent_mutation | Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| vg0132377418 | G -> A | LOC_Os01g56210-LOC_Os01g56220 | intergenic_region ; MODIFIER | silent_mutation | Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0132377418 | 2.48E-06 | NA | mr1079_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132377418 | NA | 5.93E-06 | mr1720_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |