Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0132377418:

Variant ID: vg0132377418 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 32377418
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATGTGGCGCGCCTGCAACTTCACCTTCATCACCATCGCCCACTCGGCGTAGTTAGTCTTGGTGAGCATGGGCCATGCGCCGCCAACATCCTTGACGAC[G/A]
ATCTGCACAACGGGAGGAGAGCCGGAGCGTCCACGGCGACCACGGCGCCGGTCCGGGGAAGGGGAGGCGCGCTGCCTGCGAGGGCTCCGTGCGCCAACGT

Reverse complement sequence

ACGTTGGCGCACGGAGCCCTCGCAGGCAGCGCGCCTCCCCTTCCCCGGACCGGCGCCGTGGTCGCCGTGGACGCTCCGGCTCTCCTCCCGTTGTGCAGAT[C/T]
GTCGTCAAGGATGTTGGCGGCGCATGGCCCATGCTCACCAAGACTAACTACGCCGAGTGGGCGATGGTGATGAAGGTGAAGTTGCAGGCGCGCCACATGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.10%	3.30%	0.55%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	88.00%	10.30%	1.72%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	93.70%	3.70%	2.61%	0.00%	NA
Tropical Japonica	504	93.70%	6.30%	0.00%	0.00%	NA
Japonica Intermediate	241	58.10%	39.40%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0132377418	G -> A	LOC_Os01g56210.1	upstream_gene_variant ; 4549.0bp to feature; MODIFIER	silent_mutation	Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	N	N	N	N
vg0132377418	G -> A	LOC_Os01g56220.1	downstream_gene_variant ; 2342.0bp to feature; MODIFIER	silent_mutation	Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	N	N	N	N
vg0132377418	G -> A	LOC_Os01g56230.1	downstream_gene_variant ; 3792.0bp to feature; MODIFIER	silent_mutation	Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	N	N	N	N
vg0132377418	G -> A	LOC_Os01g56230.2	downstream_gene_variant ; 3792.0bp to feature; MODIFIER	silent_mutation	Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	N	N	N	N
vg0132377418	G -> A	LOC_Os01g56230.3	downstream_gene_variant ; 3792.0bp to feature; MODIFIER	silent_mutation	Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	N	N	N	N
vg0132377418	G -> A	LOC_Os01g56230.4	downstream_gene_variant ; 3792.0bp to feature; MODIFIER	silent_mutation	Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	N	N	N	N
vg0132377418	G -> A	LOC_Os01g56230.5	downstream_gene_variant ; 3792.0bp to feature; MODIFIER	silent_mutation	Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	N	N	N	N
vg0132377418	G -> A	LOC_Os01g56210-LOC_Os01g56220	intergenic_region ; MODIFIER	silent_mutation	Average:62.703; most accessible tissue: Zhenshan97 flag leaf, score: 84.295	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0132377418	2.48E-06	NA	mr1079_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132377418	NA	5.93E-06	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251