\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132376950:

Variant ID: vg0132376950 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32376950
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCTGAGGGAGGTAGCTGCTTGCGGTTGTCGACGGCCTTGAGGCGACCTGTCACCTCTTCGTTCGTGAGCTCGGTGAAGTCCAGCAGCGTCTCGATCGA[C/T]
AGAGCCAGCTGCGTGTACTTCTCGGGGACGACGCAAAGGAGCTTCTCCACGGCTCTCTCCTCATCGATGGTGGTGTCGCCGAGCTGCGCCAACCGCTGTT

Reverse complement sequence

AACAGCGGTTGGCGCAGCTCGGCGACACCACCATCGATGAGGAGAGAGCCGTGGAGAAGCTCCTTTGCGTCGTCCCCGAGAAGTACACGCAGCTGGCTCT[G/A]
TCGATCGAGACGCTGCTGGACTTCACCGAGCTCACGAACGAAGAGGTGACAGGTCGCCTCAAGGCCGTCGACAACCGCAAGCAGCTACCTCCCTCAGAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 12.30% 2.88% 0.00% NA
All Indica  2759 74.70% 20.40% 4.86% 0.00% NA
All Japonica  1512 99.50% 0.40% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.30% 13.90% 10.76% 0.00% NA
Indica II  465 30.30% 62.20% 7.53% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 71.80% 23.80% 4.45% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132376950 C -> T LOC_Os01g56210.1 upstream_gene_variant ; 4081.0bp to feature; MODIFIER silent_mutation Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0132376950 C -> T LOC_Os01g56220.1 downstream_gene_variant ; 2810.0bp to feature; MODIFIER silent_mutation Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0132376950 C -> T LOC_Os01g56230.1 downstream_gene_variant ; 4260.0bp to feature; MODIFIER silent_mutation Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0132376950 C -> T LOC_Os01g56230.2 downstream_gene_variant ; 4260.0bp to feature; MODIFIER silent_mutation Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0132376950 C -> T LOC_Os01g56230.3 downstream_gene_variant ; 4260.0bp to feature; MODIFIER silent_mutation Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0132376950 C -> T LOC_Os01g56230.4 downstream_gene_variant ; 4260.0bp to feature; MODIFIER silent_mutation Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0132376950 C -> T LOC_Os01g56230.5 downstream_gene_variant ; 4260.0bp to feature; MODIFIER silent_mutation Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N
vg0132376950 C -> T LOC_Os01g56210-LOC_Os01g56220 intergenic_region ; MODIFIER silent_mutation Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132376950 NA 3.87E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 1.25E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 8.31E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 2.91E-10 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 3.92E-11 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 5.27E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 1.38E-08 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 6.22E-12 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 1.08E-10 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 3.98E-14 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 8.68E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 1.42E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 3.67E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 9.74E-18 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 1.31E-09 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 9.18E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 1.17E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 4.73E-08 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 9.05E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 4.51E-09 mr1439_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 5.09E-07 mr1439_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 1.89E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 9.82E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 7.57E-06 mr1472_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 8.33E-08 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132376950 NA 4.83E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251