\
| Variant ID: vg0132376950 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 32376950 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 108. )
GCTCTGAGGGAGGTAGCTGCTTGCGGTTGTCGACGGCCTTGAGGCGACCTGTCACCTCTTCGTTCGTGAGCTCGGTGAAGTCCAGCAGCGTCTCGATCGA[C/T]
AGAGCCAGCTGCGTGTACTTCTCGGGGACGACGCAAAGGAGCTTCTCCACGGCTCTCTCCTCATCGATGGTGGTGTCGCCGAGCTGCGCCAACCGCTGTT
AACAGCGGTTGGCGCAGCTCGGCGACACCACCATCGATGAGGAGAGAGCCGTGGAGAAGCTCCTTTGCGTCGTCCCCGAGAAGTACACGCAGCTGGCTCT[G/A]
TCGATCGAGACGCTGCTGGACTTCACCGAGCTCACGAACGAAGAGGTGACAGGTCGCCTCAAGGCCGTCGACAACCGCAAGCAGCTACCTCCCTCAGAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.80% | 12.30% | 2.88% | 0.00% | NA |
| All Indica | 2759 | 74.70% | 20.40% | 4.86% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.30% | 13.90% | 10.76% | 0.00% | NA |
| Indica II | 465 | 30.30% | 62.20% | 7.53% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 71.80% | 23.80% | 4.45% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0132376950 | C -> T | LOC_Os01g56210.1 | upstream_gene_variant ; 4081.0bp to feature; MODIFIER | silent_mutation | Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 | N | N | N | N |
| vg0132376950 | C -> T | LOC_Os01g56220.1 | downstream_gene_variant ; 2810.0bp to feature; MODIFIER | silent_mutation | Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 | N | N | N | N |
| vg0132376950 | C -> T | LOC_Os01g56230.1 | downstream_gene_variant ; 4260.0bp to feature; MODIFIER | silent_mutation | Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 | N | N | N | N |
| vg0132376950 | C -> T | LOC_Os01g56230.2 | downstream_gene_variant ; 4260.0bp to feature; MODIFIER | silent_mutation | Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 | N | N | N | N |
| vg0132376950 | C -> T | LOC_Os01g56230.3 | downstream_gene_variant ; 4260.0bp to feature; MODIFIER | silent_mutation | Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 | N | N | N | N |
| vg0132376950 | C -> T | LOC_Os01g56230.4 | downstream_gene_variant ; 4260.0bp to feature; MODIFIER | silent_mutation | Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 | N | N | N | N |
| vg0132376950 | C -> T | LOC_Os01g56230.5 | downstream_gene_variant ; 4260.0bp to feature; MODIFIER | silent_mutation | Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 | N | N | N | N |
| vg0132376950 | C -> T | LOC_Os01g56210-LOC_Os01g56220 | intergenic_region ; MODIFIER | silent_mutation | Average:65.753; most accessible tissue: Zhenshan97 flag leaf, score: 84.864 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0132376950 | NA | 3.87E-08 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 1.25E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 8.31E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 2.91E-10 | mr1172_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 3.92E-11 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 5.27E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 1.38E-08 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 6.22E-12 | mr1327_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 1.08E-10 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 3.98E-14 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 8.68E-08 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 1.42E-11 | mr1338_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 3.67E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 9.74E-18 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 1.31E-09 | mr1352_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 9.18E-06 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 1.17E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 4.73E-08 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 9.05E-07 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 4.51E-09 | mr1439_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 5.09E-07 | mr1439_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 1.89E-09 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 9.82E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 7.57E-06 | mr1472_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 8.33E-08 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132376950 | NA | 4.83E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |