\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132361776:

Variant ID: vg0132361776 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32361776
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.54, G: 0.46, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AGCAAAACGCATAGACCCTTTAGCAATTATACTCCCTCCGTCTCAAAAAAAAGACAAACTCTAGGCTTCCGTGTCCAACATTTAACCGTCCGTCTTATTT[A/G]
AAAAAATTATGAAAAAAAATTAAAAAGACAAGTCACGCATAAAGTATTAATCATGTTTTATCATCTAACAACAATGAAAATACTAATTATAAAAAAAATT

Reverse complement sequence

AATTTTTTTTATAATTAGTATTTTCATTGTTGTTAGATGATAAAACATGATTAATACTTTATGCGTGACTTGTCTTTTTAATTTTTTTTCATAATTTTTT[T/C]
AAATAAGACGGACGGTTAAATGTTGGACACGGAAGCCTAGAGTTTGTCTTTTTTTTGAGACGGAGGGAGTATAATTGCTAAAGGGTCTATGCGTTTTGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 10.50% 0.87% 1.23% NA
All Indica  2759 97.60% 2.20% 0.07% 0.11% NA
All Japonica  1512 67.50% 27.80% 1.79% 2.98% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.00% 0.11% NA
Indica Intermediate  786 95.90% 3.60% 0.25% 0.25% NA
Temperate Japonica  767 48.90% 50.80% 0.00% 0.26% NA
Tropical Japonica  504 84.10% 2.40% 5.16% 8.33% NA
Japonica Intermediate  241 91.70% 7.50% 0.41% 0.41% NA
VI/Aromatic  96 81.20% 0.00% 8.33% 10.42% NA
Intermediate  90 81.10% 14.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132361776 A -> G LOC_Os01g56190.1 downstream_gene_variant ; 1011.0bp to feature; MODIFIER silent_mutation Average:81.57; most accessible tissue: Callus, score: 91.765 N N N N
vg0132361776 A -> G LOC_Os01g56190-LOC_Os01g56200 intergenic_region ; MODIFIER silent_mutation Average:81.57; most accessible tissue: Callus, score: 91.765 N N N N
vg0132361776 A -> DEL N N silent_mutation Average:81.57; most accessible tissue: Callus, score: 91.765 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0132361776 A G -0.02 -0.04 -0.05 -0.03 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132361776 NA 2.30E-07 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132361776 NA 2.63E-08 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132361776 NA 8.74E-11 mr1008_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132361776 NA 2.83E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132361776 4.58E-06 4.58E-06 mr1581_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251