\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132263132:

Variant ID: vg0132263132 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32263132
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTTGATCGACGGGGGCGTCAATCTCTCTTAAGGGGTGAGGATGTAACATCCCAGCCTAGGGCTTAATAGAATTAATAGAATACTCATATCAACAAGTTG[T/C]
AACTTTTTTTCCGGAAGCCAATCTCCAAAGAACTCCCGGGTTAAGCGTGCTTGGCCTAAAGCAATTTGGGATGGGTGACCGACCGGTAAATTCTTCCCGG

Reverse complement sequence

CCGGGAAGAATTTACCGGTCGGTCACCCATCCCAAATTGCTTTAGGCCAAGCACGCTTAACCCGGGAGTTCTTTGGAGATTGGCTTCCGGAAAAAAAGTT[A/G]
CAACTTGTTGATATGAGTATTCTATTAATTCTATTAAGCCCTAGGCTGGGATGTTACATCCTCACCCCTTAAGAGAGATTGACGCCCCCGTCGATCAACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.80% 3.70% 12.38% 63.10% NA
All Indica  2759 4.50% 0.00% 18.12% 77.38% NA
All Japonica  1512 55.20% 11.30% 1.12% 32.34% NA
Aus  269 0.70% 0.40% 22.68% 76.21% NA
Indica I  595 7.60% 0.00% 16.47% 75.97% NA
Indica II  465 3.90% 0.00% 11.18% 84.95% NA
Indica III  913 1.20% 0.10% 23.22% 75.47% NA
Indica Intermediate  786 6.20% 0.00% 17.56% 76.21% NA
Temperate Japonica  767 91.40% 5.60% 1.56% 1.43% NA
Tropical Japonica  504 5.60% 5.20% 0.40% 88.89% NA
Japonica Intermediate  241 44.00% 42.30% 1.24% 12.45% NA
VI/Aromatic  96 0.00% 0.00% 0.00% 100.00% NA
Intermediate  90 26.70% 2.20% 7.78% 63.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132263132 T -> DEL N N silent_mutation Average:40.248; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0132263132 T -> C LOC_Os01g56030.1 upstream_gene_variant ; 3106.0bp to feature; MODIFIER silent_mutation Average:40.248; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0132263132 T -> C LOC_Os01g56040.1 upstream_gene_variant ; 3923.0bp to feature; MODIFIER silent_mutation Average:40.248; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0132263132 T -> C LOC_Os01g56030-LOC_Os01g56040 intergenic_region ; MODIFIER silent_mutation Average:40.248; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132263132 NA 1.29E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 2.22E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 1.52E-10 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 9.13E-08 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 9.10E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 6.27E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 2.45E-07 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 2.40E-06 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 2.30E-08 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 5.97E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 6.41E-12 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 5.91E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 1.97E-06 1.18E-10 mr1720 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 5.08E-06 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 6.03E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 1.64E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 3.97E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 3.19E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 2.13E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 2.23E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 6.24E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 1.84E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 7.08E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 2.22E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 5.41E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 5.39E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 5.62E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 9.15E-11 mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 5.21E-07 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 3.31E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132263132 NA 2.98E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251