Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132256380:

Variant ID: vg0132256380 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 32256380
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCATGTGGTAGTCTCGTTTTTTATTTCAGCCCCTAGTGTTTTTCACTTTAGTACTCACAATTTTCCAATTTACTAGCAATGATGCACGTGCGTTGCAA[T/C]
GGGTAAAGGTAATTTTAATCATGTATACTGGTGGAACAAAAATAAAGGAATCATAATCATAATAATAATATTAATAAAATAAAATTGCAGTGACCTTTGG

Reverse complement sequence

CCAAAGGTCACTGCAATTTTATTTTATTAATATTATTATTATGATTATGATTCCTTTATTTTTGTTCCACCAGTATACATGATTAAAATTACCTTTACCC[A/G]
TTGCAACGCACGTGCATCATTGCTAGTAAATTGGAAAATTGTGAGTACTAAAGTGAAAAACACTAGGGGCTGAAATAAAAAACGAGACTACCACATGAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	39.00%	0.25%	0.00%	NA
All Indica	2759	43.30%	56.40%	0.25%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	1.10%	98.90%	0.00%	0.00%	NA
Indica I	595	73.60%	25.90%	0.50%	0.00%	NA
Indica II	465	70.50%	29.50%	0.00%	0.00%	NA
Indica III	913	10.20%	89.70%	0.11%	0.00%	NA
Indica Intermediate	786	42.90%	56.70%	0.38%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	17.80%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0132256380	T -> C	LOC_Os01g56010.1	upstream_gene_variant ; 4755.0bp to feature; MODIFIER	silent_mutation	Average:42.109; most accessible tissue: Callus, score: 78.967	N	N	N	N
vg0132256380	T -> C	LOC_Os01g56020.1	upstream_gene_variant ; 1358.0bp to feature; MODIFIER	silent_mutation	Average:42.109; most accessible tissue: Callus, score: 78.967	N	N	N	N
vg0132256380	T -> C	LOC_Os01g56030.1	downstream_gene_variant ; 2534.0bp to feature; MODIFIER	silent_mutation	Average:42.109; most accessible tissue: Callus, score: 78.967	N	N	N	N
vg0132256380	T -> C	LOC_Os01g56020-LOC_Os01g56030	intergenic_region ; MODIFIER	silent_mutation	Average:42.109; most accessible tissue: Callus, score: 78.967	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0132256380	NA	2.01E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132256380	NA	1.76E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132256380	3.37E-06	3.37E-06	mr1832	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132256380	NA	9.81E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132256380	NA	3.00E-15	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251