Variant ID: vg0132256380 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 32256380 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 109. )
CTTCATGTGGTAGTCTCGTTTTTTATTTCAGCCCCTAGTGTTTTTCACTTTAGTACTCACAATTTTCCAATTTACTAGCAATGATGCACGTGCGTTGCAA[T/C]
GGGTAAAGGTAATTTTAATCATGTATACTGGTGGAACAAAAATAAAGGAATCATAATCATAATAATAATATTAATAAAATAAAATTGCAGTGACCTTTGG
CCAAAGGTCACTGCAATTTTATTTTATTAATATTATTATTATGATTATGATTCCTTTATTTTTGTTCCACCAGTATACATGATTAAAATTACCTTTACCC[A/G]
TTGCAACGCACGTGCATCATTGCTAGTAAATTGGAAAATTGTGAGTACTAAAGTGAAAAACACTAGGGGCTGAAATAAAAAACGAGACTACCACATGAAG
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 60.80% | 39.00% | 0.25% | 0.00% | NA |
All Indica | 2759 | 43.30% | 56.40% | 0.25% | 0.00% | NA |
All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 73.60% | 25.90% | 0.50% | 0.00% | NA |
Indica II | 465 | 70.50% | 29.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 10.20% | 89.70% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 42.90% | 56.70% | 0.38% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 78.90% | 17.80% | 3.33% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0132256380 | T -> C | LOC_Os01g56010.1 | upstream_gene_variant ; 4755.0bp to feature; MODIFIER | silent_mutation | Average:42.109; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
vg0132256380 | T -> C | LOC_Os01g56020.1 | upstream_gene_variant ; 1358.0bp to feature; MODIFIER | silent_mutation | Average:42.109; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
vg0132256380 | T -> C | LOC_Os01g56030.1 | downstream_gene_variant ; 2534.0bp to feature; MODIFIER | silent_mutation | Average:42.109; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
vg0132256380 | T -> C | LOC_Os01g56020-LOC_Os01g56030 | intergenic_region ; MODIFIER | silent_mutation | Average:42.109; most accessible tissue: Callus, score: 78.967 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0132256380 | NA | 2.01E-06 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0132256380 | NA | 1.76E-07 | mr1587 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0132256380 | 3.37E-06 | 3.37E-06 | mr1832 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0132256380 | NA | 9.81E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0132256380 | NA | 3.00E-15 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |