\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132204145:

Variant ID: vg0132204145 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32204145
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGTAAAGATTTAATTGTTACGAACACAACGGTATAATCGGATCGTAGATCGGATGAGTAGTTTAAGAGAAAATTATATTTGAAGTATAGGTGGATGGT[G/A]
CCTCTATATAGAGTGGTAGCTGGTTTAGACAAATCAGCTGCGACCAGCGCGCGACCTCAAGTCGATCAATGTGCGACCTCAAGTCGATCAAGCTGGTAGC

Reverse complement sequence

GCTACCAGCTTGATCGACTTGAGGTCGCACATTGATCGACTTGAGGTCGCGCGCTGGTCGCAGCTGATTTGTCTAAACCAGCTACCACTCTATATAGAGG[C/T]
ACCATCCACCTATACTTCAAATATAATTTTCTCTTAAACTACTCATCCGATCTACGATCCGATTATACCGTTGTGTTCGTAACAATTAAATCTTTACAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 13.20% 7.49% 2.62% NA
All Indica  2759 70.40% 20.00% 6.38% 3.23% NA
All Japonica  1512 88.10% 0.10% 9.72% 2.12% NA
Aus  269 68.00% 23.80% 8.18% 0.00% NA
Indica I  595 54.80% 35.00% 6.89% 3.36% NA
Indica II  465 76.80% 0.40% 14.19% 8.60% NA
Indica III  913 73.90% 24.40% 1.10% 0.55% NA
Indica Intermediate  786 74.20% 15.30% 7.51% 3.05% NA
Temperate Japonica  767 95.80% 0.00% 3.78% 0.39% NA
Tropical Japonica  504 89.10% 0.00% 6.94% 3.97% NA
Japonica Intermediate  241 61.40% 0.40% 34.44% 3.73% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 86.70% 4.40% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132204145 G -> A LOC_Os01g55910.1 upstream_gene_variant ; 2079.0bp to feature; MODIFIER silent_mutation Average:61.322; most accessible tissue: Minghui63 root, score: 86.705 N N N N
vg0132204145 G -> A LOC_Os01g55900-LOC_Os01g55910 intergenic_region ; MODIFIER silent_mutation Average:61.322; most accessible tissue: Minghui63 root, score: 86.705 N N N N
vg0132204145 G -> DEL N N silent_mutation Average:61.322; most accessible tissue: Minghui63 root, score: 86.705 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0132204145 G A -0.01 0.02 0.02 0.02 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132204145 NA 2.10E-06 mr1280 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 4.20E-06 mr1641 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 1.71E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 3.87E-09 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 4.90E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 5.00E-06 2.15E-07 mr1759 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 2.32E-09 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 2.01E-06 mr1901 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 6.47E-06 mr1906 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 6.62E-09 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 6.52E-08 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 7.05E-06 mr1960 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 7.81E-06 7.81E-06 mr1985 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 7.18E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 7.21E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 7.92E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 7.55E-07 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132204145 NA 4.77E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251