\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132167342:

Variant ID: vg0132167342 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32167342
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAACAGTTTTGATGGTAAGCATGTAATTACGTTTTTTAAGTTGTAAATTTAATAAAATACCGGTTCAAAACAGTTACAAATAGAGATTACCTATACAT[T/C]
TTTCGAAAGATTTTTATGATCGTATCACATAGATTTTTAATCTTTGAATTAAAATCCAATAGATATAATAAAAAGCAAAAAGCAATTAAGAAACACTATA

Reverse complement sequence

TATAGTGTTTCTTAATTGCTTTTTGCTTTTTATTATATCTATTGGATTTTAATTCAAAGATTAAAAATCTATGTGATACGATCATAAAAATCTTTCGAAA[A/G]
ATGTATAGGTAATCTCTATTTGTAACTGTTTTGAACCGGTATTTTATTAAATTTACAACTTAAAAAACGTAATTACATGCTTACCATCAAAACTGTTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 19.70% 2.07% 0.78% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 35.80% 55.60% 6.28% 2.38% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 97.00% 3.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 6.00% 88.30% 5.48% 0.26% NA
Tropical Japonica  504 90.70% 6.30% 1.39% 1.59% NA
Japonica Intermediate  241 15.80% 54.40% 19.09% 10.79% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 70.00% 25.60% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132167342 T -> DEL N N silent_mutation Average:65.871; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0132167342 T -> C LOC_Os01g55860.1 upstream_gene_variant ; 539.0bp to feature; MODIFIER silent_mutation Average:65.871; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0132167342 T -> C LOC_Os01g55850.1 downstream_gene_variant ; 1546.0bp to feature; MODIFIER silent_mutation Average:65.871; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0132167342 T -> C LOC_Os01g55870.1 downstream_gene_variant ; 4380.0bp to feature; MODIFIER silent_mutation Average:65.871; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N
vg0132167342 T -> C LOC_Os01g55850-LOC_Os01g55860 intergenic_region ; MODIFIER silent_mutation Average:65.871; most accessible tissue: Minghui63 flag leaf, score: 80.786 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132167342 NA 9.58E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 4.00E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 3.26E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 1.64E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 7.65E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 2.07E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 4.85E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 2.16E-24 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 7.35E-23 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 1.03E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 1.00E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 4.05E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 7.83E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 5.23E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 9.60E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 1.08E-23 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 7.93E-13 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 5.36E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 7.72E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 8.66E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 2.43E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 9.22E-06 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 2.96E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 3.34E-23 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 3.26E-11 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 2.69E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 6.03E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 1.73E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 8.71E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 1.88E-06 NA mr1793_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 3.94E-08 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132167342 NA 1.60E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251