\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132166543:

Variant ID: vg0132166543 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32166543
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTTTGCCTGGTGTACCTTAGGACTAGGGTTCGAATCCCAGGTCAGCCATTTTCGTTTTTTTTCCTTGTTTTTTTTCTTCAAATCTTCAATCTCCGTGC[G/A,T]
TACATATAAATGATTAATGATGATTTCTGTTTTTGAAAAAAATATATACGGTACTAATCACCCTATTACCCACCAAACTGAAAGAAAACATCGGCCAACG

Reverse complement sequence

CGTTGGCCGATGTTTTCTTTCAGTTTGGTGGGTAATAGGGTGATTAGTACCGTATATATTTTTTTCAAAAACAGAAATCATCATTAATCATTTATATGTA[C/T,A]
GCACGGAGATTGAAGATTTGAAGAAAAAAAACAAGGAAAAAAAACGAAAATGGCTGACCTGGGATTCGAACCCTAGTCCTAAGGTACACCAGGCAAAGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 41.70% 0.17% 0.00% T: 0.04%
All Indica  2759 51.20% 48.50% 0.29% 0.00% T: 0.04%
All Japonica  1512 67.60% 32.40% 0.00% 0.00% NA
Aus  269 98.90% 0.70% 0.00% 0.00% T: 0.37%
Indica I  595 57.80% 41.30% 0.84% 0.00% NA
Indica II  465 9.90% 90.10% 0.00% 0.00% NA
Indica III  913 67.90% 31.90% 0.22% 0.00% NA
Indica Intermediate  786 51.30% 48.50% 0.13% 0.00% T: 0.13%
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 10.30% 89.70% 0.00% 0.00% NA
Japonica Intermediate  241 88.40% 11.60% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 37.80% 62.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132166543 G -> T LOC_Os01g55860.1 upstream_gene_variant ; 1338.0bp to feature; MODIFIER silent_mutation Average:85.233; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0132166543 G -> T LOC_Os01g55850.1 downstream_gene_variant ; 747.0bp to feature; MODIFIER silent_mutation Average:85.233; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0132166543 G -> T LOC_Os01g55850-LOC_Os01g55860 intergenic_region ; MODIFIER silent_mutation Average:85.233; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0132166543 G -> A LOC_Os01g55860.1 upstream_gene_variant ; 1338.0bp to feature; MODIFIER silent_mutation Average:85.233; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0132166543 G -> A LOC_Os01g55850.1 downstream_gene_variant ; 747.0bp to feature; MODIFIER silent_mutation Average:85.233; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N
vg0132166543 G -> A LOC_Os01g55850-LOC_Os01g55860 intergenic_region ; MODIFIER silent_mutation Average:85.233; most accessible tissue: Zhenshan97 panicle, score: 92.403 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0132166543 G A -0.04 -0.03 -0.03 -0.02 -0.03 -0.02
vg0132166543 G T 0.01 0.01 0.01 0.0 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132166543 NA 7.66E-15 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0132166543 NA 3.71E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0132166543 NA 4.25E-11 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 8.99E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 3.80E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 2.23E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 1.12E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 3.21E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 1.50E-06 mr1633 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 1.78E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 8.49E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 9.76E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 3.86E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 2.96E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 3.91E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 9.18E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 9.19E-13 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 5.50E-07 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 3.65E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 2.79E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 2.03E-13 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 2.93E-11 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 4.24E-11 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 6.49E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 4.93E-15 mr1364_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 5.16E-07 mr1364_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 7.97E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 5.38E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 1.68E-14 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 1.59E-15 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 7.89E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 3.44E-14 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 1.19E-08 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 2.08E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 8.74E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132166543 NA 1.11E-13 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251