\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132153349:

Variant ID: vg0132153349 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32153349
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.52, T: 0.48, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTATAAAAAAATAAAAAAAAGTTACACATAAAATATTATTCATATTTTATCATCTAATAACAATAAAAATATTATATATTTTTTTAAATAAGACGAAC[T/G]
GTCAAACTTTGTATATATAAACCGTACAAAATTGCACTTGGGACTGAGGGAGTACTTGCTAGCGCGCCAACGAGGCGTCGAGATCCGAGCAGCACTGGAG

Reverse complement sequence

CTCCAGTGCTGCTCGGATCTCGACGCCTCGTTGGCGCGCTAGCAAGTACTCCCTCAGTCCCAAGTGCAATTTTGTACGGTTTATATATACAAAGTTTGAC[A/C]
GTTCGTCTTATTTAAAAAAATATATAATATTTTTATTGTTATTAGATGATAAAATATGAATAATATTTTATGTGTAACTTTTTTTTATTTTTTTATAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.70% 20.10% 2.88% 8.29% NA
All Indica  2759 86.30% 2.10% 4.35% 7.25% NA
All Japonica  1512 30.20% 57.10% 0.93% 11.84% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 87.10% 3.40% 5.88% 3.70% NA
Indica II  465 73.10% 1.30% 9.46% 16.13% NA
Indica III  913 95.80% 0.00% 0.55% 3.61% NA
Indica Intermediate  786 82.60% 3.90% 4.58% 8.91% NA
Temperate Japonica  767 1.20% 94.30% 0.13% 4.43% NA
Tropical Japonica  504 82.10% 5.60% 1.98% 10.32% NA
Japonica Intermediate  241 13.70% 46.50% 1.24% 38.59% NA
VI/Aromatic  96 86.50% 8.30% 0.00% 5.21% NA
Intermediate  90 65.60% 23.30% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132153349 T -> G LOC_Os01g55830.1 upstream_gene_variant ; 1233.0bp to feature; MODIFIER silent_mutation Average:62.88; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0132153349 T -> G LOC_Os01g55840.1 downstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:62.88; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0132153349 T -> G LOC_Os01g55830-LOC_Os01g55840 intergenic_region ; MODIFIER silent_mutation Average:62.88; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N
vg0132153349 T -> DEL N N silent_mutation Average:62.88; most accessible tissue: Zhenshan97 root, score: 85.432 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132153349 NA 1.99E-14 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 7.67E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.31E-22 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.30E-09 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 9.19E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.13E-06 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 4.33E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 2.71E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 2.45E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 8.44E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.23E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 4.31E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 9.25E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 3.03E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 7.17E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 2.35E-17 mr1740 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.23E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 7.65E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 8.82E-45 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 9.93E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 4.85E-14 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 2.26E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 4.35E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.32E-50 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.17E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.97E-12 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 1.79E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 6.44E-12 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 5.37E-21 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 7.47E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132153349 NA 2.33E-13 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251