\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132120323:

Variant ID: vg0132120323 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 32120323
Reference Allele: AAlternative Allele: ACGGCAGG
Primary Allele: ASecondary Allele: ACGGCAGG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCGAGACGAGCGGGAAAAAAAAAATTAACGAGGGGGCAATGGGACGCACTGCACGCGCCATCGGACGGAGAGAGAAGCAGCGCGCGGCAGACGGGCAG[A/ACGGCAGG]
CGGCAGGCGGCAGGTCGATCAGGTGTGTGTGTGACCGTGGCTGACTGCATGCATGTGTCGCGGGCCGGGCCGCGGCCGGTGGCCAGACGAGAAGAGTTCA

Reverse complement sequence

TGAACTCTTCTCGTCTGGCCACCGGCCGCGGCCCGGCCCGCGACACATGCATGCAGTCAGCCACGGTCACACACACACCTGATCGACCTGCCGCCTGCCG[T/CCTGCCGT]
CTGCCCGTCTGCCGCGCGCTGCTTCTCTCTCCGTCCGATGGCGCGTGCAGTGCGTCCCATTGCCCCCTCGTTAATTTTTTTTTTCCCGCTCGTCTCGCGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of ACGGCAGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 3.30% 0.00% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 89.90% 10.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 95.60% 4.40% 0.00% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 60.20% 39.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132120323 A -> ACGGCAGG LOC_Os01g55770.1 downstream_gene_variant ; 2923.0bp to feature; MODIFIER silent_mutation Average:95.541; most accessible tissue: Zhenshan97 panicle, score: 98.006 N N N N
vg0132120323 A -> ACGGCAGG LOC_Os01g55750-LOC_Os01g55770 intergenic_region ; MODIFIER silent_mutation Average:95.541; most accessible tissue: Zhenshan97 panicle, score: 98.006 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0132120323 A ACGGC* -0.27 -0.14 -0.06 0.07 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132120323 NA 8.73E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 2.75E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 1.93E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 1.18E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 1.37E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 5.94E-07 mr1826 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 1.59E-06 NA mr1935 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 2.14E-16 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 1.12E-11 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 4.04E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 4.39E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132120323 NA 1.47E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251