\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132085326:

Variant ID: vg0132085326 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32085326
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TATACATGACATCGACTTATAATTGTTGAAACATTACAAAACATTTGTTGAAATATCCCAAGAATACCATGTGCAACATTTCAAATGAATAAGTGAAACA[T/C]
AAGAAAATAGTTATTAAACCATCCAAACAACACCATGTGCAACATTAAAATTAAATAAATATCGCAACAAAGAAAACTTAAAATCTGCAACAAACTCGAA

Reverse complement sequence

TTCGAGTTTGTTGCAGATTTTAAGTTTTCTTTGTTGCGATATTTATTTAATTTTAATGTTGCACATGGTGTTGTTTGGATGGTTTAATAACTATTTTCTT[A/G]
TGTTTCACTTATTCATTTGAAATGTTGCACATGGTATTCTTGGGATATTTCAACAAATGTTTTGTAATGTTTCAACAATTATAAGTCGATGTCATGTATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.70% 20.30% 20.10% 11.87% NA
All Indica  2759 59.00% 1.10% 24.57% 15.30% NA
All Japonica  1512 18.80% 59.40% 13.49% 8.33% NA
Aus  269 95.90% 0.40% 3.72% 0.00% NA
Indica I  595 63.20% 0.80% 22.18% 13.78% NA
Indica II  465 26.90% 1.10% 41.51% 30.54% NA
Indica III  913 74.00% 0.00% 17.20% 8.76% NA
Indica Intermediate  786 57.50% 2.50% 24.94% 15.01% NA
Temperate Japonica  767 3.40% 95.70% 0.65% 0.26% NA
Tropical Japonica  504 30.40% 10.10% 35.71% 23.81% NA
Japonica Intermediate  241 43.60% 46.90% 7.88% 1.66% NA
VI/Aromatic  96 54.20% 9.40% 33.33% 3.12% NA
Intermediate  90 36.70% 23.30% 28.89% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132085326 T -> DEL N N silent_mutation Average:26.967; most accessible tissue: Callus, score: 55.445 N N N N
vg0132085326 T -> C LOC_Os01g55700.1 upstream_gene_variant ; 2838.0bp to feature; MODIFIER silent_mutation Average:26.967; most accessible tissue: Callus, score: 55.445 N N N N
vg0132085326 T -> C LOC_Os01g55710.1 downstream_gene_variant ; 1633.0bp to feature; MODIFIER silent_mutation Average:26.967; most accessible tissue: Callus, score: 55.445 N N N N
vg0132085326 T -> C LOC_Os01g55720.1 downstream_gene_variant ; 2930.0bp to feature; MODIFIER silent_mutation Average:26.967; most accessible tissue: Callus, score: 55.445 N N N N
vg0132085326 T -> C LOC_Os01g55710-LOC_Os01g55720 intergenic_region ; MODIFIER silent_mutation Average:26.967; most accessible tissue: Callus, score: 55.445 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132085326 NA 4.37E-13 mr1010 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.28E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 8.17E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 2.87E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.45E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 8.25E-23 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.06E-09 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 9.88E-07 mr1403 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.22E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 4.74E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.40E-12 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 4.01E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.87E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 8.69E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 2.92E-30 mr1789 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 6.57E-16 mr1844 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 4.90E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 4.13E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 8.33E-25 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 7.49E-12 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 2.87E-08 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 7.50E-25 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.22E-60 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.62E-12 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 2.79E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.42E-20 mr1361_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.72E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.04E-07 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.35E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.67E-22 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 5.80E-07 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 7.42E-11 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 8.06E-43 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 2.64E-29 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 3.18E-11 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 9.17E-07 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.63E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 1.60E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326 NA 7.63E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251