Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132085326:

Variant ID: vg0132085326 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 32085326
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

TATACATGACATCGACTTATAATTGTTGAAACATTACAAAACATTTGTTGAAATATCCCAAGAATACCATGTGCAACATTTCAAATGAATAAGTGAAACA[T/C]
AAGAAAATAGTTATTAAACCATCCAAACAACACCATGTGCAACATTAAAATTAAATAAATATCGCAACAAAGAAAACTTAAAATCTGCAACAAACTCGAA

Reverse complement sequence

TTCGAGTTTGTTGCAGATTTTAAGTTTTCTTTGTTGCGATATTTATTTAATTTTAATGTTGCACATGGTGTTGTTTGGATGGTTTAATAACTATTTTCTT[A/G]
TGTTTCACTTATTCATTTGAAATGTTGCACATGGTATTCTTGGGATATTTCAACAAATGTTTTGTAATGTTTCAACAATTATAAGTCGATGTCATGTATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.70%	20.30%	20.10%	11.87%	NA
All Indica	2759	59.00%	1.10%	24.57%	15.30%	NA
All Japonica	1512	18.80%	59.40%	13.49%	8.33%	NA
Aus	269	95.90%	0.40%	3.72%	0.00%	NA
Indica I	595	63.20%	0.80%	22.18%	13.78%	NA
Indica II	465	26.90%	1.10%	41.51%	30.54%	NA
Indica III	913	74.00%	0.00%	17.20%	8.76%	NA
Indica Intermediate	786	57.50%	2.50%	24.94%	15.01%	NA
Temperate Japonica	767	3.40%	95.70%	0.65%	0.26%	NA
Tropical Japonica	504	30.40%	10.10%	35.71%	23.81%	NA
Japonica Intermediate	241	43.60%	46.90%	7.88%	1.66%	NA
VI/Aromatic	96	54.20%	9.40%	33.33%	3.12%	NA
Intermediate	90	36.70%	23.30%	28.89%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0132085326	T -> DEL	N	N	silent_mutation	Average:26.967; most accessible tissue: Callus, score: 55.445	N	N	N	N
vg0132085326	T -> C	LOC_Os01g55700.1	upstream_gene_variant ; 2838.0bp to feature; MODIFIER	silent_mutation	Average:26.967; most accessible tissue: Callus, score: 55.445	N	N	N	N
vg0132085326	T -> C	LOC_Os01g55710.1	downstream_gene_variant ; 1633.0bp to feature; MODIFIER	silent_mutation	Average:26.967; most accessible tissue: Callus, score: 55.445	N	N	N	N
vg0132085326	T -> C	LOC_Os01g55720.1	downstream_gene_variant ; 2930.0bp to feature; MODIFIER	silent_mutation	Average:26.967; most accessible tissue: Callus, score: 55.445	N	N	N	N
vg0132085326	T -> C	LOC_Os01g55710-LOC_Os01g55720	intergenic_region ; MODIFIER	silent_mutation	Average:26.967; most accessible tissue: Callus, score: 55.445	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0132085326	NA	4.37E-13	mr1010	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.28E-12	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	8.17E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	2.87E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.45E-23	mr1115	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	8.25E-23	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.06E-09	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	9.88E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.22E-08	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	4.74E-24	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.40E-12	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	4.01E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.87E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	8.69E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	2.92E-30	mr1789	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	6.57E-16	mr1844	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	4.90E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	4.13E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	8.33E-25	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	7.49E-12	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	2.87E-08	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	7.50E-25	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.22E-60	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.62E-12	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	2.79E-07	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.42E-20	mr1361_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.72E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.04E-07	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.35E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.67E-22	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	5.80E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	7.42E-11	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	8.06E-43	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	2.64E-29	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	3.18E-11	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	9.17E-07	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.63E-12	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	1.60E-10	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132085326	NA	7.63E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251