\
| Variant ID: vg0132040691 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 32040691 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, T: 0.34, others allele: 0.00, population size: 103. )
TAATATGATATATAACACTTTACAAACATGAGTGGTCAAACTGTACAAATGGTAACAAAAGGAACTCATTAAAAAAATAGTTAACGCATATTTAAATTTA[A/T]
ATTTTTTATTTTAATATAACTCGTAGAAATTAAATTTGAATTTGCATATTTGTGAAGTGATATTTTTAAAATAATCTATATTGTTAATTATTATTTTTAT
ATAAAAATAATAATTAACAATATAGATTATTTTAAAAATATCACTTCACAAATATGCAAATTCAAATTTAATTTCTACGAGTTATATTAAAATAAAAAAT[T/A]
TAAATTTAAATATGCGTTAACTATTTTTTTAATGAGTTCCTTTTGTTACCATTTGTACAGTTTGACCACTCATGTTTGTAAAGTGTTATATATCATATTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 24.70% | 4.30% | 2.77% | NA |
| All Indica | 2759 | 88.60% | 7.20% | 1.56% | 2.65% | NA |
| All Japonica | 1512 | 30.40% | 55.70% | 10.32% | 3.57% | NA |
| Aus | 269 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 77.10% | 19.80% | 0.84% | 2.18% | NA |
| Indica II | 465 | 83.90% | 4.10% | 4.30% | 7.74% | NA |
| Indica III | 913 | 99.30% | 0.20% | 0.11% | 0.33% | NA |
| Indica Intermediate | 786 | 87.70% | 7.50% | 2.16% | 2.67% | NA |
| Temperate Japonica | 767 | 0.90% | 73.80% | 19.30% | 6.00% | NA |
| Tropical Japonica | 504 | 84.10% | 15.10% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 12.00% | 83.00% | 2.90% | 2.07% | NA |
| VI/Aromatic | 96 | 88.50% | 9.40% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 70.00% | 23.30% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0132040691 | A -> T | LOC_Os01g55610.1 | upstream_gene_variant ; 313.0bp to feature; MODIFIER | silent_mutation | Average:46.158; most accessible tissue: Callus, score: 88.789 | N | N | N | N |
| vg0132040691 | A -> T | LOC_Os01g55610-LOC_Os01g55620 | intergenic_region ; MODIFIER | silent_mutation | Average:46.158; most accessible tissue: Callus, score: 88.789 | N | N | N | N |
| vg0132040691 | A -> DEL | N | N | silent_mutation | Average:46.158; most accessible tissue: Callus, score: 88.789 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0132040691 | NA | 8.71E-14 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.07E-08 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 3.20E-15 | mr1540 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.50E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.31E-06 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 4.60E-16 | mr1732 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 6.04E-06 | mr1896 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.46E-06 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.06E-06 | mr1097_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 2.49E-06 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 7.09E-17 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 8.20E-06 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 3.10E-07 | mr1446_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 9.38E-11 | mr1471_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 3.40E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 4.29E-15 | mr1539_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 4.15E-15 | mr1540_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 9.35E-06 | mr1616_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 8.03E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | 5.43E-07 | 5.43E-07 | mr1663_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 7.24E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.62E-17 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.05E-13 | mr1732_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 2.95E-09 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | 3.47E-06 | 3.47E-06 | mr1760_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 9.92E-10 | mr1771_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 4.18E-06 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.43E-10 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 1.51E-06 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 9.35E-08 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 7.85E-09 | mr1862_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 6.12E-07 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132040691 | NA | 2.29E-07 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |