\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0132040691:

Variant ID: vg0132040691 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 32040691
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, T: 0.34, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TAATATGATATATAACACTTTACAAACATGAGTGGTCAAACTGTACAAATGGTAACAAAAGGAACTCATTAAAAAAATAGTTAACGCATATTTAAATTTA[A/T]
ATTTTTTATTTTAATATAACTCGTAGAAATTAAATTTGAATTTGCATATTTGTGAAGTGATATTTTTAAAATAATCTATATTGTTAATTATTATTTTTAT

Reverse complement sequence

ATAAAAATAATAATTAACAATATAGATTATTTTAAAAATATCACTTCACAAATATGCAAATTCAAATTTAATTTCTACGAGTTATATTAAAATAAAAAAT[T/A]
TAAATTTAAATATGCGTTAACTATTTTTTTAATGAGTTCCTTTTGTTACCATTTGTACAGTTTGACCACTCATGTTTGTAAAGTGTTATATATCATATTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 24.70% 4.30% 2.77% NA
All Indica  2759 88.60% 7.20% 1.56% 2.65% NA
All Japonica  1512 30.40% 55.70% 10.32% 3.57% NA
Aus  269 64.70% 35.30% 0.00% 0.00% NA
Indica I  595 77.10% 19.80% 0.84% 2.18% NA
Indica II  465 83.90% 4.10% 4.30% 7.74% NA
Indica III  913 99.30% 0.20% 0.11% 0.33% NA
Indica Intermediate  786 87.70% 7.50% 2.16% 2.67% NA
Temperate Japonica  767 0.90% 73.80% 19.30% 6.00% NA
Tropical Japonica  504 84.10% 15.10% 0.20% 0.60% NA
Japonica Intermediate  241 12.00% 83.00% 2.90% 2.07% NA
VI/Aromatic  96 88.50% 9.40% 1.04% 1.04% NA
Intermediate  90 70.00% 23.30% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0132040691 A -> T LOC_Os01g55610.1 upstream_gene_variant ; 313.0bp to feature; MODIFIER silent_mutation Average:46.158; most accessible tissue: Callus, score: 88.789 N N N N
vg0132040691 A -> T LOC_Os01g55610-LOC_Os01g55620 intergenic_region ; MODIFIER silent_mutation Average:46.158; most accessible tissue: Callus, score: 88.789 N N N N
vg0132040691 A -> DEL N N silent_mutation Average:46.158; most accessible tissue: Callus, score: 88.789 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0132040691 NA 8.71E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.07E-08 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 3.20E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.50E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.31E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 4.60E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 6.04E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.46E-06 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.06E-06 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 2.49E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 7.09E-17 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 8.20E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 3.10E-07 mr1446_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 9.38E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 3.40E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 4.29E-15 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 4.15E-15 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 9.35E-06 mr1616_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 8.03E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 5.43E-07 5.43E-07 mr1663_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 7.24E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.62E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.05E-13 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 2.95E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 3.47E-06 3.47E-06 mr1760_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 9.92E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 4.18E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.43E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 1.51E-06 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 9.35E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 7.85E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 6.12E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0132040691 NA 2.29E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251