| Variant ID: vg0132025232 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 32025232 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 109. )
ATCATTAAAAAATAGCTTAAAAATTTAAACTAATAAACTTATAAAAAAAATGGAACGCTTTATTAGAGATATGGATAAACAAGGAAAGAACATACTCCCT[C/T]
CATCCTGAAAAAAAAATCTAGGACTAGCTGTGATATATTTTAGTATAATAAATCTGAACAGATGTATGTCTCACATTGATAATCTTCAGCAGACATTTAG
CTAAATGTCTGCTGAAGATTATCAATGTGAGACATACATCTGTTCAGATTTATTATACTAAAATATATCACAGCTAGTCCTAGATTTTTTTTTCAGGATG[G/A]
AGGGAGTATGTTCTTTCCTTGTTTATCCATATCTCTAATAAAGCGTTCCATTTTTTTTATAAGTTTATTAGTTTAAATTTTTAAGCTATTTTTTAATGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.10% | 19.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 71.10% | 28.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 40.30% | 59.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 74.50% | 25.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 75.40% | 24.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0132025232 | C -> T | LOC_Os01g55580.1 | upstream_gene_variant ; 2831.0bp to feature; MODIFIER | silent_mutation | Average:59.043; most accessible tissue: Callus, score: 93.725 | N | N | N | N |
| vg0132025232 | C -> T | LOC_Os01g55590.1 | upstream_gene_variant ; 1073.0bp to feature; MODIFIER | silent_mutation | Average:59.043; most accessible tissue: Callus, score: 93.725 | N | N | N | N |
| vg0132025232 | C -> T | LOC_Os01g55580.2 | upstream_gene_variant ; 2831.0bp to feature; MODIFIER | silent_mutation | Average:59.043; most accessible tissue: Callus, score: 93.725 | N | N | N | N |
| vg0132025232 | C -> T | LOC_Os01g55580-LOC_Os01g55590 | intergenic_region ; MODIFIER | silent_mutation | Average:59.043; most accessible tissue: Callus, score: 93.725 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0132025232 | NA | 2.31E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | 1.18E-06 | NA | mr1089 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | 8.84E-06 | 8.64E-07 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | NA | 7.94E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | NA | 5.48E-07 | mr1214 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | 6.97E-06 | NA | mr1243 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | NA | 3.27E-06 | mr1319 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | NA | 1.13E-06 | mr1343 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | NA | 6.51E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0132025232 | NA | 8.42E-13 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/