Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131972121:

Variant ID: vg0131972121 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 31972121
Reference Allele: G	Alternative Allele: A,GAAA,GAA
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.09, G: 0.02, others allele: 0.00, population size: 154. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGTATGTTATAGTCGAGGTTTATCCATTATGCTGTACTTGTGGATTATATAGTGCAATTTTGACAAACAATTGAACATTAGAATACAGCTTCACTTGG[G/A,GAAA,GAA]
AAAAAAAAAGAATGTAGGATGTGTTTTTAAACCTCAAAGTAACTTCCAATCTTCTTTATGATATGCTTGTAAACCTGCAGCTTGCGTCTATTCTGGGGGG

Reverse complement sequence

CCCCCCAGAATAGACGCAAGCTGCAGGTTTACAAGCATATCATAAAGAAGATTGGAAGTTACTTTGAGGTTTAAAAACACATCCTACATTCTTTTTTTTT[C/T,TTTC,TTC]
CCAAGTGAAGCTGTATTCTAATGTTCAATTGTTTGTCAAAATTGCACTATATAATCCACAAGTACAGCATAATGGATAAACCTCGACTATAACATACCGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.00%	32.20%	0.55%	0.02%	GAA: 0.13%; GAAA: 0.04%
All Indica	2759	85.00%	14.80%	0.07%	0.00%	GAA: 0.11%; GAAA: 0.07%
All Japonica	1512	30.50%	68.00%	1.39%	0.07%	GAA: 0.07%
Aus	269	81.00%	18.60%	0.00%	0.00%	GAA: 0.37%
Indica I	595	54.80%	45.20%	0.00%	0.00%	NA
Indica II	465	98.30%	1.30%	0.22%	0.00%	GAAA: 0.22%
Indica III	913	98.50%	1.30%	0.00%	0.00%	GAA: 0.11%; GAAA: 0.11%
Indica Intermediate	786	84.40%	15.30%	0.13%	0.00%	GAA: 0.25%
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	84.70%	13.30%	1.79%	0.00%	GAA: 0.20%
Japonica Intermediate	241	11.20%	83.40%	4.98%	0.41%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	62.20%	33.30%	3.33%	0.00%	GAA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0131972121	G -> GAA	LOC_Os01g55500.1	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAA	LOC_Os01g55500.4	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAA	LOC_Os01g55500.2	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAA	LOC_Os01g55500.3	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAA	LOC_Os01g55490.1	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAA	LOC_Os01g55490.2	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAA	LOC_Os01g55490.4	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAA	LOC_Os01g55490.3	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> A	LOC_Os01g55500.1	upstream_gene_variant ; 3871.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> A	LOC_Os01g55500.4	upstream_gene_variant ; 3871.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> A	LOC_Os01g55500.2	upstream_gene_variant ; 3871.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> A	LOC_Os01g55500.3	upstream_gene_variant ; 3871.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> A	LOC_Os01g55490.1	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> A	LOC_Os01g55490.2	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> A	LOC_Os01g55490.4	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> A	LOC_Os01g55490.3	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> DEL	N	N	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAAA	LOC_Os01g55500.1	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAAA	LOC_Os01g55500.4	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAAA	LOC_Os01g55500.2	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAAA	LOC_Os01g55500.3	upstream_gene_variant ; 3870.0bp to feature; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAAA	LOC_Os01g55490.1	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAAA	LOC_Os01g55490.2	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAAA	LOC_Os01g55490.4	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N
vg0131972121	G -> GAAA	LOC_Os01g55490.3	intron_variant ; MODIFIER	silent_mutation	Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0131972121	NA	7.35E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	6.11E-06	mr1106	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.92E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.62E-06	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.33E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	9.35E-08	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	9.13E-06	mr1306	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	8.03E-06	mr1319	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.63E-06	mr1327	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	3.50E-07	mr1343	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.12E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.94E-06	mr1386	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.55E-06	mr1406	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.22E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.29E-07	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	4.08E-15	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	7.30E-09	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	3.77E-10	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.13E-06	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	8.79E-09	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	9.07E-09	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.88E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	7.07E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	5.76E-16	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	4.47E-09	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.71E-06	mr1896	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	3.16E-06	mr1901	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.88E-07	mr1901	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.29E-07	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	7.02E-07	mr1921	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	3.40E-09	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.34E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.23E-06	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.38E-08	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	6.92E-07	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.58E-07	mr1274_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	9.01E-08	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	6.34E-06	mr1406_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	8.71E-06	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	6.29E-14	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	5.76E-15	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	1.00E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	3.23E-07	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.94E-07	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.56E-10	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	2.10E-08	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	8.72E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	8.02E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121	NA	5.67E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251