\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131972121:

Variant ID: vg0131972121 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 31972121
Reference Allele: GAlternative Allele: A,GAAA,GAA
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, T: 0.09, G: 0.02, others allele: 0.00, population size: 154. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGTATGTTATAGTCGAGGTTTATCCATTATGCTGTACTTGTGGATTATATAGTGCAATTTTGACAAACAATTGAACATTAGAATACAGCTTCACTTGG[G/A,GAAA,GAA]
AAAAAAAAAGAATGTAGGATGTGTTTTTAAACCTCAAAGTAACTTCCAATCTTCTTTATGATATGCTTGTAAACCTGCAGCTTGCGTCTATTCTGGGGGG

Reverse complement sequence

CCCCCCAGAATAGACGCAAGCTGCAGGTTTACAAGCATATCATAAAGAAGATTGGAAGTTACTTTGAGGTTTAAAAACACATCCTACATTCTTTTTTTTT[C/T,TTTC,TTC]
CCAAGTGAAGCTGTATTCTAATGTTCAATTGTTTGTCAAAATTGCACTATATAATCCACAAGTACAGCATAATGGATAAACCTCGACTATAACATACCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.00% 32.20% 0.55% 0.02% GAA: 0.13%; GAAA: 0.04%
All Indica  2759 85.00% 14.80% 0.07% 0.00% GAA: 0.11%; GAAA: 0.07%
All Japonica  1512 30.50% 68.00% 1.39% 0.07% GAA: 0.07%
Aus  269 81.00% 18.60% 0.00% 0.00% GAA: 0.37%
Indica I  595 54.80% 45.20% 0.00% 0.00% NA
Indica II  465 98.30% 1.30% 0.22% 0.00% GAAA: 0.22%
Indica III  913 98.50% 1.30% 0.00% 0.00% GAA: 0.11%; GAAA: 0.11%
Indica Intermediate  786 84.40% 15.30% 0.13% 0.00% GAA: 0.25%
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 84.70% 13.30% 1.79% 0.00% GAA: 0.20%
Japonica Intermediate  241 11.20% 83.40% 4.98% 0.41% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 62.20% 33.30% 3.33% 0.00% GAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131972121 G -> GAA LOC_Os01g55500.1 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAA LOC_Os01g55500.4 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAA LOC_Os01g55500.2 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAA LOC_Os01g55500.3 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAA LOC_Os01g55490.1 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAA LOC_Os01g55490.2 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAA LOC_Os01g55490.4 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAA LOC_Os01g55490.3 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> A LOC_Os01g55500.1 upstream_gene_variant ; 3871.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> A LOC_Os01g55500.4 upstream_gene_variant ; 3871.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> A LOC_Os01g55500.2 upstream_gene_variant ; 3871.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> A LOC_Os01g55500.3 upstream_gene_variant ; 3871.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> A LOC_Os01g55490.1 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> A LOC_Os01g55490.2 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> A LOC_Os01g55490.4 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> A LOC_Os01g55490.3 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> DEL N N silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAAA LOC_Os01g55500.1 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAAA LOC_Os01g55500.4 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAAA LOC_Os01g55500.2 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAAA LOC_Os01g55500.3 upstream_gene_variant ; 3870.0bp to feature; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAAA LOC_Os01g55490.1 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAAA LOC_Os01g55490.2 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAAA LOC_Os01g55490.4 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N
vg0131972121 G -> GAAA LOC_Os01g55490.3 intron_variant ; MODIFIER silent_mutation Average:41.914; most accessible tissue: Minghui63 flower, score: 56.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131972121 NA 7.35E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 6.11E-06 mr1106 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.92E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.62E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.33E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 9.35E-08 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 9.13E-06 mr1306 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 8.03E-06 mr1319 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.63E-06 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 3.50E-07 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.12E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.94E-06 mr1386 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.55E-06 mr1406 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.22E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.29E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 4.08E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 7.30E-09 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 3.77E-10 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.13E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 8.79E-09 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 9.07E-09 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.88E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 7.07E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 5.76E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 4.47E-09 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.71E-06 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 3.16E-06 mr1901 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.88E-07 mr1901 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.29E-07 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 7.02E-07 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 3.40E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.34E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.23E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.38E-08 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 6.92E-07 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.58E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 9.01E-08 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 6.34E-06 mr1406_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 8.71E-06 mr1480_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 6.29E-14 mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 5.76E-15 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 1.00E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 3.23E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.94E-07 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.56E-10 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 2.10E-08 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 8.72E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 8.02E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131972121 NA 5.67E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251