\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131955794:

Variant ID: vg0131955794 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31955794
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.13, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAGGGAGAGAGAATTGGGAAGATTGGGAAGATACGCAAAACGAGGTGAGTCATTAGCTCATGATTAATTGAGTATTAACTATTTTCAAATTTAAAAAT[G/A]
GATTAATATGATTTTTTAAAGCAACTTTTCTATAGAAAATTTTTACAAAAAACGCACCGTTTAGTAGTTTGAAAAGCGTGCGCGTGAAAAACGAGTGACA

Reverse complement sequence

TGTCACTCGTTTTTCACGCGCACGCTTTTCAAACTACTAAACGGTGCGTTTTTTGTAAAAATTTTCTATAGAAAAGTTGCTTTAAAAAATCATATTAATC[C/T]
ATTTTTAAATTTGAAAATAGTTAATACTCAATTAATCATGAGCTAATGACTCACCTCGTTTTGCGTATCTTCCCAATCTTCCCAATTCTCTCTCCCTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 14.80% 0.02% 0.00% NA
All Indica  2759 74.60% 25.30% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 50.50% 49.40% 0.11% 0.00% NA
Indica Intermediate  786 74.30% 25.70% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131955794 G -> A LOC_Os01g55470.1 downstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:47.653; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N
vg0131955794 G -> A LOC_Os01g55450-LOC_Os01g55470 intergenic_region ; MODIFIER silent_mutation Average:47.653; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131955794 NA 9.73E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131955794 NA 1.29E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131955794 NA 9.08E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131955794 NA 4.44E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131955794 2.95E-06 NA mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131955794 NA 4.28E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131955794 NA 4.52E-06 mr1895 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131955794 NA 1.65E-06 mr1895 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251