Variant ID: vg0131955794 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 31955794 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.86, A: 0.13, others allele: 0.00, population size: 99. )
TTGAGGGAGAGAGAATTGGGAAGATTGGGAAGATACGCAAAACGAGGTGAGTCATTAGCTCATGATTAATTGAGTATTAACTATTTTCAAATTTAAAAAT[G/A]
GATTAATATGATTTTTTAAAGCAACTTTTCTATAGAAAATTTTTACAAAAAACGCACCGTTTAGTAGTTTGAAAAGCGTGCGCGTGAAAAACGAGTGACA
TGTCACTCGTTTTTCACGCGCACGCTTTTCAAACTACTAAACGGTGCGTTTTTTGTAAAAATTTTCTATAGAAAAGTTGCTTTAAAAAATCATATTAATC[C/T]
ATTTTTAAATTTGAAAATAGTTAATACTCAATTAATCATGAGCTAATGACTCACCTCGTTTTGCGTATCTTCCCAATCTTCCCAATTCTCTCTCCCTCAA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 85.10% | 14.80% | 0.02% | 0.00% | NA |
All Indica | 2759 | 74.60% | 25.30% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 50.50% | 49.40% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 74.30% | 25.70% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0131955794 | G -> A | LOC_Os01g55470.1 | downstream_gene_variant ; 1705.0bp to feature; MODIFIER | silent_mutation | Average:47.653; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 | N | N | N | N |
vg0131955794 | G -> A | LOC_Os01g55450-LOC_Os01g55470 | intergenic_region ; MODIFIER | silent_mutation | Average:47.653; most accessible tissue: Zhenshan97 flag leaf, score: 91.191 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0131955794 | NA | 9.73E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131955794 | NA | 1.29E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131955794 | NA | 9.08E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131955794 | NA | 4.44E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131955794 | 2.95E-06 | NA | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131955794 | NA | 4.28E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131955794 | NA | 4.52E-06 | mr1895 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131955794 | NA | 1.65E-06 | mr1895 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |