\
| Variant ID: vg0131880868 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31880868 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )
GGTTGTCGTGCATTGGATCCGGCAGGAGTGCCCCAGGTCAGAGCTACTTGTTAGCAGAATAATTGAATTCTTCATGCTGTTAATTTTCAGGTGCTTTTAG[C/T]
CACCTGTAGCAAATGTTGACTGCATGATAAAAAAACTAAACTTTGTTTACTTGTGAATTGTTGCATTACGGTGATCTACAAAAATCTACCTTTTCATTTT
AAAATGAAAAGGTAGATTTTTGTAGATCACCGTAATGCAACAATTCACAAGTAAACAAAGTTTAGTTTTTTTATCATGCAGTCAACATTTGCTACAGGTG[G/A]
CTAAAAGCACCTGAAAATTAACAGCATGAAGAATTCAATTATTCTGCTAACAAGTAGCTCTGACCTGGGGCACTCCTGCCGGATCCAATGCACGACAACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.70% | 0.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131880868 | C -> T | LOC_Os01g55360.1 | upstream_gene_variant ; 3261.0bp to feature; MODIFIER | N | Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0131880868 | C -> T | LOC_Os01g55360.3 | upstream_gene_variant ; 3978.0bp to feature; MODIFIER | N | Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0131880868 | C -> T | LOC_Os01g55360.2 | upstream_gene_variant ; 3261.0bp to feature; MODIFIER | N | Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0131880868 | C -> T | LOC_Os01g55360.4 | upstream_gene_variant ; 3261.0bp to feature; MODIFIER | N | Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0131880868 | C -> T | LOC_Os01g55360-LOC_Os01g55370 | intergenic_region ; MODIFIER | N | Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131880868 | NA | 9.86E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 8.23E-06 | 8.23E-06 | mr1288 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | NA | 2.98E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 4.33E-06 | NA | mr1533_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 3.32E-06 | NA | mr1600_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 4.57E-06 | 7.02E-06 | mr1600_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | NA | 2.87E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 9.87E-07 | 2.22E-06 | mr1887_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 4.84E-07 | 9.87E-07 | mr1887_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 4.34E-06 | 4.34E-06 | mr1939_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 7.28E-06 | 7.28E-06 | mr1941_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131880868 | 4.39E-06 | 4.39E-06 | mr1941_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |