\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131880868:

Variant ID: vg0131880868 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31880868
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGTCGTGCATTGGATCCGGCAGGAGTGCCCCAGGTCAGAGCTACTTGTTAGCAGAATAATTGAATTCTTCATGCTGTTAATTTTCAGGTGCTTTTAG[C/T]
CACCTGTAGCAAATGTTGACTGCATGATAAAAAAACTAAACTTTGTTTACTTGTGAATTGTTGCATTACGGTGATCTACAAAAATCTACCTTTTCATTTT

Reverse complement sequence

AAAATGAAAAGGTAGATTTTTGTAGATCACCGTAATGCAACAATTCACAAGTAAACAAAGTTTAGTTTTTTTATCATGCAGTCAACATTTGCTACAGGTG[G/A]
CTAAAAGCACCTGAAAATTAACAGCATGAAGAATTCAATTATTCTGCTAACAAGTAGCTCTGACCTGGGGCACTCCTGCCGGATCCAATGCACGACAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.70% 0.20% 0.06% 0.00% NA
All Indica  2759 99.50% 0.40% 0.11% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 0.90% 0.43% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.60% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131880868 C -> T LOC_Os01g55360.1 upstream_gene_variant ; 3261.0bp to feature; MODIFIER N Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0131880868 C -> T LOC_Os01g55360.3 upstream_gene_variant ; 3978.0bp to feature; MODIFIER N Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0131880868 C -> T LOC_Os01g55360.2 upstream_gene_variant ; 3261.0bp to feature; MODIFIER N Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0131880868 C -> T LOC_Os01g55360.4 upstream_gene_variant ; 3261.0bp to feature; MODIFIER N Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0131880868 C -> T LOC_Os01g55360-LOC_Os01g55370 intergenic_region ; MODIFIER N Average:33.24; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131880868 NA 9.86E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 8.23E-06 8.23E-06 mr1288 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 NA 2.98E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 4.33E-06 NA mr1533_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 3.32E-06 NA mr1600_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 4.57E-06 7.02E-06 mr1600_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 NA 2.87E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 9.87E-07 2.22E-06 mr1887_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 4.84E-07 9.87E-07 mr1887_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 4.34E-06 4.34E-06 mr1939_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 7.28E-06 7.28E-06 mr1941_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131880868 4.39E-06 4.39E-06 mr1941_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251