\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131859112:

Variant ID: vg0131859112 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31859112
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGAATTTTAGATTGGGTTGTTTGCAGGGTTAAGTTCCCTACTTCAATGGCCGTATATATCTGGTTGAATGTAGAGGCCAGGTAAAAAAAAAAACCCTT[C/T]
CCAAAAAAAAATCAACCAATGCTGCAAGAATAGATTTTGTTTTTTTTACTCACTTCCAGTTCCTGTTCCCTTCCTCTTTTGGTTTGTATGGCCCTTGCTT

Reverse complement sequence

AAGCAAGGGCCATACAAACCAAAAGAGGAAGGGAACAGGAACTGGAAGTGAGTAAAAAAAACAAAATCTATTCTTGCAGCATTGGTTGATTTTTTTTTGG[G/A]
AAGGGTTTTTTTTTTTACCTGGCCTCTACATTCAACCAGATATATACGGCCATTGAAGTAGGGAACTTAACCCTGCAAACAACCCAATCTAAAATTCGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.80% 20.60% 0.80% 2.77% NA
All Indica  2759 66.60% 30.70% 0.87% 1.88% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 20.10% 46.50% 4.46% 29.00% NA
Indica I  595 94.60% 5.00% 0.17% 0.17% NA
Indica II  465 95.90% 3.90% 0.00% 0.22% NA
Indica III  913 34.20% 61.80% 0.44% 3.61% NA
Indica Intermediate  786 65.60% 29.80% 2.42% 2.16% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131859112 C -> T LOC_Os01g55350.1 downstream_gene_variant ; 219.0bp to feature; MODIFIER silent_mutation Average:59.415; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0131859112 C -> T LOC_Os01g55340-LOC_Os01g55350 intergenic_region ; MODIFIER silent_mutation Average:59.415; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0131859112 C -> DEL N N silent_mutation Average:59.415; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131859112 NA 1.36E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0131859112 NA 5.37E-07 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 4.84E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 5.40E-08 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 6.52E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 1.62E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 5.76E-08 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 1.40E-07 mr1244 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 3.40E-08 mr1286 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 1.65E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 6.04E-07 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 1.96E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 3.78E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 3.94E-06 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 2.62E-12 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 1.63E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 4.04E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 9.07E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 9.40E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 1.47E-15 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 2.80E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 2.11E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 6.33E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131859112 NA 9.58E-07 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251