\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131842159:

Variant ID: vg0131842159 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31842159
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGGAGTGGAGTAGACACAGATACAAACTAAAAGAGTGGAGCGGGGTTCGGGTCATCTCATATCACCACTCTGGATTACACCCCTAGAGTTAGATTTAT[T/G]
AGTTAGGGCCTTATCAAACAGTCTCTTACAGTTTCAGAGATTGTACTAACAAAATTTCATCGCGAGCAAAATAGTGTCAGTCATGCTTTAGCTAGTAGAG

Reverse complement sequence

CTCTACTAGCTAAAGCATGACTGACACTATTTTGCTCGCGATGAAATTTTGTTAGTACAATCTCTGAAACTGTAAGAGACTGTTTGATAAGGCCCTAACT[A/C]
ATAAATCTAACTCTAGGGGTGTAATCCAGAGTGGTGATATGAGATGACCCGAACCCCGCTCCACTCTTTTAGTTTGTATCTGTGTCTACTCCACTCCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.20% 0.25% 0.02% NA
All Indica  2759 85.10% 14.50% 0.36% 0.04% NA
All Japonica  1512 10.60% 89.40% 0.00% 0.00% NA
Aus  269 84.00% 15.60% 0.37% 0.00% NA
Indica I  595 54.80% 44.70% 0.34% 0.17% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 84.50% 14.50% 1.02% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 28.60% 71.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131842159 T -> G LOC_Os01g55310.1 upstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:88.857; most accessible tissue: Zhenshan97 flower, score: 94.377 N N N N
vg0131842159 T -> G LOC_Os01g55320.1 upstream_gene_variant ; 1062.0bp to feature; MODIFIER silent_mutation Average:88.857; most accessible tissue: Zhenshan97 flower, score: 94.377 N N N N
vg0131842159 T -> G LOC_Os01g55330.1 downstream_gene_variant ; 4230.0bp to feature; MODIFIER silent_mutation Average:88.857; most accessible tissue: Zhenshan97 flower, score: 94.377 N N N N
vg0131842159 T -> G LOC_Os01g55320-LOC_Os01g55330 intergenic_region ; MODIFIER silent_mutation Average:88.857; most accessible tissue: Zhenshan97 flower, score: 94.377 N N N N
vg0131842159 T -> DEL N N silent_mutation Average:88.857; most accessible tissue: Zhenshan97 flower, score: 94.377 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0131842159 T G -0.03 -0.01 -0.01 -0.01 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131842159 NA 4.08E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 1.77E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 4.21E-09 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 2.27E-06 mr1219 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 6.74E-08 mr1274 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 9.22E-06 mr1319 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 6.60E-06 mr1343 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 1.73E-06 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 3.02E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 4.04E-08 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 7.88E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 2.74E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 4.80E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 3.90E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 2.89E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 6.45E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 6.56E-11 mr1659 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 4.25E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 3.45E-09 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 6.13E-06 mr1901 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 1.23E-06 mr1901 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 1.08E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 1.24E-07 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 1.07E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 2.81E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 9.36E-07 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 3.41E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 3.55E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 5.54E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 1.07E-07 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 5.56E-08 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 1.95E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 4.42E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 2.55E-18 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 3.03E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131842159 NA 3.15E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251