\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131798662:

Variant ID: vg0131798662 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31798662
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 322. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCACCTTCCACACTGTTGGATGTGGCCTATATATAAATGTCTTTACGTACACACATAGGAGCATAAGTATGATATATCACAGGTTCATACTAAGAGCA[A/G]
GTTTAATGCATAGTATAGCCAACTACTAGCTCCAAAATCATCTATAGCCAATGTAATAGTCAATTTATACAATAGTTGCTTACTACAAAATTAATACAGA

Reverse complement sequence

TCTGTATTAATTTTGTAGTAAGCAACTATTGTATAAATTGACTATTACATTGGCTATAGATGATTTTGGAGCTAGTAGTTGGCTATACTATGCATTAAAC[T/C]
TGCTCTTAGTATGAACCTGTGATATATCATACTTATGCTCCTATGTGTGTACGTAAAGACATTTATATATAGGCCACATCCAACAGTGTGGAAGGTGGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.10% 2.20% 0.40% 1.31% NA
All Indica  2759 95.70% 3.80% 0.51% 0.07% NA
All Japonica  1512 95.70% 0.00% 0.33% 3.97% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 86.60% 11.80% 1.68% 0.00% NA
Indica II  465 99.40% 0.00% 0.65% 0.00% NA
Indica III  913 97.60% 2.20% 0.11% 0.11% NA
Indica Intermediate  786 98.10% 1.80% 0.00% 0.13% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 87.90% 0.00% 0.60% 11.51% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131798662 A -> G LOC_Os01g55250.1 upstream_gene_variant ; 1240.0bp to feature; MODIFIER silent_mutation Average:52.51; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0131798662 A -> G LOC_Os01g55240.1 downstream_gene_variant ; 1019.0bp to feature; MODIFIER silent_mutation Average:52.51; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0131798662 A -> G LOC_Os01g55240-LOC_Os01g55250 intergenic_region ; MODIFIER silent_mutation Average:52.51; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N
vg0131798662 A -> DEL N N silent_mutation Average:52.51; most accessible tissue: Zhenshan97 panicle, score: 75.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131798662 NA 4.34E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131798662 NA 1.17E-07 mr1707 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131798662 NA 1.14E-09 mr1728 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131798662 NA 2.51E-08 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131798662 NA 2.10E-07 mr1728_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131798662 NA 2.66E-09 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251