\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131794141:

Variant ID: vg0131794141 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31794141
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTAACTTAAATGAGAGTTGTTGTATTACTTACCTCCTTGCACAAATGTAAGACGTTGGTTAGTTTAATTTTTAGCTAACCAACGTCAAACAAAAAAAT[G/A]
GAGGGAGTATAAAACAAACTAACTAATTTTGAATGCTGAAATTCACCATACGTTATACAAGTTGTTTCTAAAATTTAAATTTTAAACTTGATTACTATTT

Reverse complement sequence

AAATAGTAATCAAGTTTAAAATTTAAATTTTAGAAACAACTTGTATAACGTATGGTGAATTTCAGCATTCAAAATTAGTTAGTTTGTTTTATACTCCCTC[C/T]
ATTTTTTTGTTTGACGTTGGTTAGCTAAAAATTAAACTAACCAACGTCTTACATTTGTGCAAGGAGGTAAGTAATACAACAACTCTCATTTAAGTTACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.30% 0.04% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 89.90% 10.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 72.20% 27.60% 0.20% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131794141 G -> A LOC_Os01g55240.1 upstream_gene_variant ; 964.0bp to feature; MODIFIER silent_mutation Average:42.635; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N
vg0131794141 G -> A LOC_Os01g55220-LOC_Os01g55240 intergenic_region ; MODIFIER silent_mutation Average:42.635; most accessible tissue: Zhenshan97 panicle, score: 61.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131794141 NA 1.18E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131794141 6.63E-06 4.45E-09 mr1220_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131794141 NA 2.45E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131794141 NA 7.88E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131794141 NA 8.47E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251