\
| Variant ID: vg0131772066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31772066 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )
TTGTGGTGGAAATTGCCCACTCGTGTTCAAGTCCCAGACTTCTTTCAGTGGTAGACAACGTACCCATCGACAGTGAGGCACTCATGGTGACTTTGTCAAT[C/A]
TCAAAATATGTCGGCCCAATCTCTCAGAGGTACTCATAGGGGGTAAAGTGTGCATGTGTGCGTTCGTAGGGGTGAGTGTGCGTGTGTTGTGAGCGCACTT
AAGTGCGCTCACAACACACGCACACTCACCCCTACGAACGCACACATGCACACTTTACCCCCTATGAGTACCTCTGAGAGATTGGGCCGACATATTTTGA[G/T]
ATTGACAAAGTCACCATGAGTGCCTCACTGTCGATGGGTACGTTGTCTACCACTGAAAGAAGTCTGGGACTTGAACACGAGTGGGCAATTTCCACCACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.60% | 14.60% | 0.47% | 1.31% | NA |
| All Indica | 2759 | 99.60% | 0.20% | 0.04% | 0.18% | NA |
| All Japonica | 1512 | 56.70% | 38.20% | 1.39% | 3.70% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 99.70% | 0.20% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 99.00% | 0.50% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 76.30% | 23.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 35.50% | 50.20% | 3.77% | 10.52% | NA |
| Japonica Intermediate | 241 | 38.60% | 59.80% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 22.90% | 77.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131772066 | C -> A | LOC_Os01g55220-LOC_Os01g55240 | intergenic_region ; MODIFIER | silent_mutation | Average:44.602; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| vg0131772066 | C -> DEL | N | N | silent_mutation | Average:44.602; most accessible tissue: Zhenshan97 panicle, score: 67.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131772066 | NA | 2.91E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 1.76E-13 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 2.39E-14 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 1.06E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 8.11E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 1.17E-14 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 3.02E-06 | mr1773 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 4.67E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 1.01E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 2.71E-08 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 5.62E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | NA | 7.32E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131772066 | 9.47E-06 | 2.84E-11 | mr1947_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |