\
| Variant ID: vg0131722579 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31722579 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGGTAGGGCGCGATGGCGACGGTCGTCGGCGGCAGGCGATGCGCGGTGGAGTAGCGCCGAGGACGGGGGTTGGCGGCTAGTTCGGGCGACGAGCGTTGG[C/T]
GTCAAGCGGCGCTGGGTGGAGTGGGCGGCAGAGGCGGAGAAAAAGGAGAGGGGAGTTGTGTCGCGATGGGAGGCGTCGCTCGATAAGGATGCGGAGAGAA
TTCTCTCCGCATCCTTATCGAGCGACGCCTCCCATCGCGACACAACTCCCCTCTCCTTTTTCTCCGCCTCTGCCGCCCACTCCACCCAGCGCCGCTTGAC[G/A]
CCAACGCTCGTCGCCCGAACTAGCCGCCAACCCCCGTCCTCGGCGCTACTCCACCGCGCATCGCCTGCCGCCGACGACCGTCGCCATCGCGCCCTACCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 16.40% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 56.10% | 43.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 74.80% | 25.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.30% | 82.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 71.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 33.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131722579 | C -> T | LOC_Os01g55120.1 | upstream_gene_variant ; 2771.0bp to feature; MODIFIER | silent_mutation | Average:70.774; most accessible tissue: Zhenshan97 young leaf, score: 84.814 | N | N | N | N |
| vg0131722579 | C -> T | LOC_Os01g55130.1 | downstream_gene_variant ; 20.0bp to feature; MODIFIER | silent_mutation | Average:70.774; most accessible tissue: Zhenshan97 young leaf, score: 84.814 | N | N | N | N |
| vg0131722579 | C -> T | LOC_Os01g55140.1 | downstream_gene_variant ; 1698.0bp to feature; MODIFIER | silent_mutation | Average:70.774; most accessible tissue: Zhenshan97 young leaf, score: 84.814 | N | N | N | N |
| vg0131722579 | C -> T | LOC_Os01g55130-LOC_Os01g55140 | intergenic_region ; MODIFIER | silent_mutation | Average:70.774; most accessible tissue: Zhenshan97 young leaf, score: 84.814 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131722579 | NA | 4.29E-12 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131722579 | NA | 2.72E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131722579 | NA | 9.11E-11 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131722579 | NA | 8.25E-06 | mr1154 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131722579 | 2.04E-06 | 2.95E-11 | mr1846 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |