\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131722579:

Variant ID: vg0131722579 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31722579
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGTAGGGCGCGATGGCGACGGTCGTCGGCGGCAGGCGATGCGCGGTGGAGTAGCGCCGAGGACGGGGGTTGGCGGCTAGTTCGGGCGACGAGCGTTGG[C/T]
GTCAAGCGGCGCTGGGTGGAGTGGGCGGCAGAGGCGGAGAAAAAGGAGAGGGGAGTTGTGTCGCGATGGGAGGCGTCGCTCGATAAGGATGCGGAGAGAA

Reverse complement sequence

TTCTCTCCGCATCCTTATCGAGCGACGCCTCCCATCGCGACACAACTCCCCTCTCCTTTTTCTCCGCCTCTGCCGCCCACTCCACCCAGCGCCGCTTGAC[G/A]
CCAACGCTCGTCGCCCGAACTAGCCGCCAACCCCCGTCCTCGGCGCTACTCCACCGCGCATCGCCTGCCGCCGACGACCGTCGCCATCGCGCCCTACCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.40% 0.08% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 56.10% 43.80% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 74.80% 25.20% 0.00% 0.00% NA
Tropical Japonica  504 17.30% 82.50% 0.20% 0.00% NA
Japonica Intermediate  241 77.60% 22.40% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 63.30% 33.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131722579 C -> T LOC_Os01g55120.1 upstream_gene_variant ; 2771.0bp to feature; MODIFIER silent_mutation Average:70.774; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N
vg0131722579 C -> T LOC_Os01g55130.1 downstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:70.774; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N
vg0131722579 C -> T LOC_Os01g55140.1 downstream_gene_variant ; 1698.0bp to feature; MODIFIER silent_mutation Average:70.774; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N
vg0131722579 C -> T LOC_Os01g55130-LOC_Os01g55140 intergenic_region ; MODIFIER silent_mutation Average:70.774; most accessible tissue: Zhenshan97 young leaf, score: 84.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131722579 NA 4.29E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131722579 NA 2.72E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131722579 NA 9.11E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131722579 NA 8.25E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131722579 2.04E-06 2.95E-11 mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251