\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131720791:

Variant ID: vg0131720791 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31720791
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


TATCATTTGCATATAAAGGCCGAATTTAGTTCCAAAATTTTTCTTTAAACTTTCAACTTTTCCATCACATCAAGGGTGTGTTTAGTTCACGTCAAAATTA[G/A]
AAGTTTGGTTGAAATTGGAACGATGTGATGGAAAAGTTGGAAGTTTATGTGTGTAAGAAAATTTTGATGTGATGGAAAAGTTAGAAGTTTGAAGAAAAAC

Reverse complement sequence

GTTTTTCTTCAAACTTCTAACTTTTCCATCACATCAAAATTTTCTTACACACATAAACTTCCAACTTTTCCATCACATCGTTCCAATTTCAACCAAACTT[C/T]
TAATTTTGACGTGAACTAAACACACCCTTGATGTGATGGAAAAGTTGAAAGTTTAAAGAAAAATTTTGGAACTAAATTCGGCCTTTATATGCAAATGATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 35.60% 0.00% 0.00% NA
All Indica  2759 96.90% 3.10% 0.00% 0.00% NA
All Japonica  1512 3.20% 96.80% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 94.30% 5.70% 0.00% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 27.10% 72.90% 0.00% 0.00% NA
Intermediate  90 31.10% 68.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131720791 G -> A LOC_Os01g55120.1 upstream_gene_variant ; 983.0bp to feature; MODIFIER silent_mutation Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0131720791 G -> A LOC_Os01g55130.1 upstream_gene_variant ; 1427.0bp to feature; MODIFIER silent_mutation Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0131720791 G -> A LOC_Os01g55140.1 downstream_gene_variant ; 3486.0bp to feature; MODIFIER silent_mutation Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0131720791 G -> A LOC_Os01g55120-LOC_Os01g55130 intergenic_region ; MODIFIER silent_mutation Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131720791 NA 1.03E-27 mr1003 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 NA 4.21E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 NA 3.23E-16 mr1010 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 NA 5.87E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 NA 8.54E-27 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 NA 1.69E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 2.84E-06 NA mr1097 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 NA 3.56E-23 mr1163 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 NA 8.01E-27 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791 NA 9.84E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251