\
| Variant ID: vg0131720791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31720791 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 105. )
TATCATTTGCATATAAAGGCCGAATTTAGTTCCAAAATTTTTCTTTAAACTTTCAACTTTTCCATCACATCAAGGGTGTGTTTAGTTCACGTCAAAATTA[G/A]
AAGTTTGGTTGAAATTGGAACGATGTGATGGAAAAGTTGGAAGTTTATGTGTGTAAGAAAATTTTGATGTGATGGAAAAGTTAGAAGTTTGAAGAAAAAC
GTTTTTCTTCAAACTTCTAACTTTTCCATCACATCAAAATTTTCTTACACACATAAACTTCCAACTTTTCCATCACATCGTTCCAATTTCAACCAAACTT[C/T]
TAATTTTGACGTGAACTAAACACACCCTTGATGTGATGGAAAAGTTGAAAGTTTAAAGAAAAATTTTGGAACTAAATTCGGCCTTTATATGCAAATGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 3.20% | 96.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 31.10% | 68.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131720791 | G -> A | LOC_Os01g55120.1 | upstream_gene_variant ; 983.0bp to feature; MODIFIER | silent_mutation | Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0131720791 | G -> A | LOC_Os01g55130.1 | upstream_gene_variant ; 1427.0bp to feature; MODIFIER | silent_mutation | Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0131720791 | G -> A | LOC_Os01g55140.1 | downstream_gene_variant ; 3486.0bp to feature; MODIFIER | silent_mutation | Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0131720791 | G -> A | LOC_Os01g55120-LOC_Os01g55130 | intergenic_region ; MODIFIER | silent_mutation | Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131720791 | NA | 1.03E-27 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | NA | 4.21E-06 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | NA | 3.23E-16 | mr1010 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | NA | 5.87E-13 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | NA | 8.54E-27 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | NA | 1.69E-06 | mr1051 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | 2.84E-06 | NA | mr1097 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | NA | 3.56E-23 | mr1163 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | NA | 8.01E-27 | mr1051_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131720791 | NA | 9.84E-08 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |