RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0131720791:

Variant ID: vg0131720791 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 31720791
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TATCATTTGCATATAAAGGCCGAATTTAGTTCCAAAATTTTTCTTTAAACTTTCAACTTTTCCATCACATCAAGGGTGTGTTTAGTTCACGTCAAAATTA[G/A]
AAGTTTGGTTGAAATTGGAACGATGTGATGGAAAAGTTGGAAGTTTATGTGTGTAAGAAAATTTTGATGTGATGGAAAAGTTAGAAGTTTGAAGAAAAAC

Reverse complement sequence

GTTTTTCTTCAAACTTCTAACTTTTCCATCACATCAAAATTTTCTTACACACATAAACTTCCAACTTTTCCATCACATCGTTCCAATTTCAACCAAACTT[C/T]
TAATTTTGACGTGAACTAAACACACCCTTGATGTGATGGAAAAGTTGAAAGTTTAAAGAAAAATTTTGGAACTAAATTCGGCCTTTATATGCAAATGATA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	35.60%	0.00%	0.00%	NA
All Indica	2759	96.90%	3.10%	0.00%	0.00%	NA
All Japonica	1512	3.20%	96.80%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	95.30%	4.70%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	94.30%	5.70%	0.00%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	7.10%	92.90%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	31.10%	68.90%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0131720791	G -> A	LOC_Os01g55120.1	upstream_gene_variant ; 983.0bp to feature; MODIFIER	silent_mutation	Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0131720791	G -> A	LOC_Os01g55130.1	upstream_gene_variant ; 1427.0bp to feature; MODIFIER	silent_mutation	Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0131720791	G -> A	LOC_Os01g55140.1	downstream_gene_variant ; 3486.0bp to feature; MODIFIER	silent_mutation	Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0131720791	G -> A	LOC_Os01g55120-LOC_Os01g55130	intergenic_region ; MODIFIER	silent_mutation	Average:39.924; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0131720791	NA	1.03E-27	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	NA	4.21E-06	mr1003	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	NA	3.23E-16	mr1010	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	NA	5.87E-13	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	NA	8.54E-27	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	NA	1.69E-06	mr1051	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	2.84E-06	NA	mr1097	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	NA	3.56E-23	mr1163	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	NA	8.01E-27	mr1051_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131720791	NA	9.84E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 10 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0131720791:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact