\
| Variant ID: vg0131565439 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 31565439 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 272. )
AATCTATAAATCCTTTAAATTTTGTGATAAAGAAAGTACACAAAAGACGGAACTCGCAATGAAATGGATGACTACTCCCGCACGAGCATAACTTGTCGGC[C/T]
GATAGAATCGAATACAAGTCTTCCCTCCCTCACATCCCCCTCTTGCCTCTCCATCCGATCTTAGAAAAATAAAGCATGTGTCACGGAGATGACAACTTAT
ATAAGTTGTCATCTCCGTGACACATGCTTTATTTTTCTAAGATCGGATGGAGAGGCAAGAGGGGGATGTGAGGGAGGGAAGACTTGTATTCGATTCTATC[G/A]
GCCGACAAGTTATGCTCGTGCGGGAGTAGTCATCCATTTCATTGCGAGTTCCGTCTTTTGTGTACTTTCTTTATCACAAAATTTAAAGGATTTATAGATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.40% | 12.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 78.40% | 21.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 55.60% | 44.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 80.80% | 19.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0131565439 | C -> T | LOC_Os01g54870.1 | upstream_gene_variant ; 4603.0bp to feature; MODIFIER | silent_mutation | Average:77.103; most accessible tissue: Callus, score: 94.189 | N | N | N | N |
| vg0131565439 | C -> T | LOC_Os01g54880.1 | upstream_gene_variant ; 1273.0bp to feature; MODIFIER | silent_mutation | Average:77.103; most accessible tissue: Callus, score: 94.189 | N | N | N | N |
| vg0131565439 | C -> T | LOC_Os01g54890.1 | upstream_gene_variant ; 2452.0bp to feature; MODIFIER | silent_mutation | Average:77.103; most accessible tissue: Callus, score: 94.189 | N | N | N | N |
| vg0131565439 | C -> T | LOC_Os01g54900.1 | downstream_gene_variant ; 3469.0bp to feature; MODIFIER | silent_mutation | Average:77.103; most accessible tissue: Callus, score: 94.189 | N | N | N | N |
| vg0131565439 | C -> T | LOC_Os01g54880-LOC_Os01g54890 | intergenic_region ; MODIFIER | silent_mutation | Average:77.103; most accessible tissue: Callus, score: 94.189 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0131565439 | NA | 8.05E-07 | mr1237 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131565439 | 8.14E-07 | NA | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131565439 | 6.05E-06 | NA | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131565439 | 2.51E-06 | 1.82E-07 | mr1677 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131565439 | 7.49E-06 | 8.20E-07 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131565439 | NA | 3.30E-06 | mr1678 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0131565439 | NA | 5.53E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |