\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131565439:

Variant ID: vg0131565439 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31565439
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTATAAATCCTTTAAATTTTGTGATAAAGAAAGTACACAAAAGACGGAACTCGCAATGAAATGGATGACTACTCCCGCACGAGCATAACTTGTCGGC[C/T]
GATAGAATCGAATACAAGTCTTCCCTCCCTCACATCCCCCTCTTGCCTCTCCATCCGATCTTAGAAAAATAAAGCATGTGTCACGGAGATGACAACTTAT

Reverse complement sequence

ATAAGTTGTCATCTCCGTGACACATGCTTTATTTTTCTAAGATCGGATGGAGAGGCAAGAGGGGGATGTGAGGGAGGGAAGACTTGTATTCGATTCTATC[G/A]
GCCGACAAGTTATGCTCGTGCGGGAGTAGTCATCCATTTCATTGCGAGTTCCGTCTTTTGTGTACTTTCTTTATCACAAAATTTAAAGGATTTATAGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 12.60% 0.04% 0.00% NA
All Indica  2759 78.40% 21.50% 0.07% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 55.60% 44.10% 0.22% 0.00% NA
Indica Intermediate  786 80.80% 19.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131565439 C -> T LOC_Os01g54870.1 upstream_gene_variant ; 4603.0bp to feature; MODIFIER silent_mutation Average:77.103; most accessible tissue: Callus, score: 94.189 N N N N
vg0131565439 C -> T LOC_Os01g54880.1 upstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:77.103; most accessible tissue: Callus, score: 94.189 N N N N
vg0131565439 C -> T LOC_Os01g54890.1 upstream_gene_variant ; 2452.0bp to feature; MODIFIER silent_mutation Average:77.103; most accessible tissue: Callus, score: 94.189 N N N N
vg0131565439 C -> T LOC_Os01g54900.1 downstream_gene_variant ; 3469.0bp to feature; MODIFIER silent_mutation Average:77.103; most accessible tissue: Callus, score: 94.189 N N N N
vg0131565439 C -> T LOC_Os01g54880-LOC_Os01g54890 intergenic_region ; MODIFIER silent_mutation Average:77.103; most accessible tissue: Callus, score: 94.189 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131565439 NA 8.05E-07 mr1237 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131565439 8.14E-07 NA mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131565439 6.05E-06 NA mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131565439 2.51E-06 1.82E-07 mr1677 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131565439 7.49E-06 8.20E-07 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131565439 NA 3.30E-06 mr1678 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131565439 NA 5.53E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251