Variant ID: vg0131535738 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 31535738 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
TGTCTTATTCTCTGGAGGCTGAATCTTCTTGATCGCATTAACACTCCTTTGAGTTACCTCGATCCCCCTCTCATGAACAAGAAATCCCAAAAACTGGCCA[G/A]
CCGATACACCAAAAGCACATTTTGTCGGATTCATCCTCAGACCATATTTTCTGGCCTTATTCAAATTTCGGAAATCAATGCATACCCTGACCTTGCTGTT
AACAGCAAGGTCAGGGTATGCATTGATTTCCGAAATTTGAATAAGGCCAGAAAATATGGTCTGAGGATGAATCCGACAAAATGTGCTTTTGGTGTATCGG[C/T]
TGGCCAGTTTTTGGGATTTCTTGTTCATGAGAGGGGGATCGAGGTAACTCAAAGGAGTGTTAATGCGATCAAGAAGATTCAGCCTCCAGAGAATAAGACA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 69.50% | 30.40% | 0.06% | 0.00% | NA |
All Indica | 2759 | 48.80% | 51.10% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 54.60% | 44.90% | 0.50% | 0.00% | NA |
Indica II | 465 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 67.30% | 32.70% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 48.70% | 51.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0131535738 | G -> A | LOC_Os01g54830.1 | missense_variant ; p.Ala862Val; MODERATE | nonsynonymous_codon ; A862V | Average:23.417; most accessible tissue: Zhenshan97 flag leaf, score: 33.231 | benign ![]() |
0.719 ![]() |
TOLERATED | 0.05 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0131535738 | NA | 1.59E-19 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0131535738 | NA | 1.13E-15 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0131535738 | NA | 2.15E-21 | mr1003 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131535738 | NA | 8.04E-06 | mr1003 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131535738 | NA | 1.54E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131535738 | NA | 1.77E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131535738 | NA | 8.82E-14 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131535738 | NA | 3.88E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131535738 | NA | 1.55E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0131535738 | NA | 2.32E-21 | mr1051 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/