Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131505293:

Variant ID: vg0131505293 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 31505293
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTCTACTCGTTCACTGGTCCTCGAACCAGTACGTAGCAATCTCTCGCACCGCAACCTCAGATGGTCGAGGTACGACTGCAGCAATAACGCAGCGGTC[C/T]
TTGTACTACGACTTCAAATGATCGAGAGACACCTACTCACTGGTCCTCAACCAGTCAATTGTAGCGATCTCTCGTACATTTACTTCTAGTGGTTGAGTTA

Reverse complement sequence

TAACTCAACCACTAGAAGTAAATGTACGAGAGATCGCTACAATTGACTGGTTGAGGACCAGTGAGTAGGTGTCTCTCGATCATTTGAAGTCGTAGTACAA[G/A]
GACCGCTGCGTTATTGCTGCAGTCGTACCTCGACCATCTGAGGTTGCGGTGCGAGAGATTGCTACGTACTGGTTCGAGGACCAGTGAACGAGTAGAATTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	36.20%	0.04%	0.00%	NA
All Indica	2759	97.40%	2.50%	0.07%	0.00%	NA
All Japonica	1512	2.10%	97.90%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	95.30%	4.50%	0.17%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	4.10%	0.13%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	4.00%	96.00%	0.00%	0.00%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	24.40%	75.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0131505293	C -> T	LOC_Os01g54770.1	upstream_gene_variant ; 3349.0bp to feature; MODIFIER	silent_mutation	Average:25.91; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0131505293	C -> T	LOC_Os01g54750.1	downstream_gene_variant ; 2320.0bp to feature; MODIFIER	silent_mutation	Average:25.91; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N
vg0131505293	C -> T	LOC_Os01g54760.1	intron_variant ; MODIFIER	silent_mutation	Average:25.91; most accessible tissue: Zhenshan97 flag leaf, score: 43.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0131505293	NA	9.08E-07	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505293	NA	1.70E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505293	NA	5.21E-07	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505293	4.80E-07	9.94E-09	mr1781	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505293	NA	6.70E-06	mr1959	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505293	NA	1.44E-06	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131505293	NA	6.48E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251